Transcript: Human NM_001143676.1

Homo sapiens serum/glucocorticoid regulated kinase 1 (SGK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SGK1 (6446)
Length:
3208
CDS:
599..2179

Additional Resources:

NCBI RefSeq record:
NM_001143676.1
NBCI Gene record:
SGK1 (6446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145161 AGACTACATTAATGGTGGAG pXPR_003 AGG 829 52% 8 0.3327 SGK1 SGK1 77460
2 BRDN0001145930 AGAAGCATATTATGTCGGAG pXPR_003 CGG 720 46% 8 0.0262 SGK1 SGK1 77457
3 BRDN0001146486 AACTTACTGTTTGCATGCAT pXPR_003 AGG 427 27% 4 -0.4714 SGK1 SGK1 77459
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271154 GTCTGTACATTGGGTTATAAC pLKO_005 3007 3UTR 100% 13.200 18.480 N Sgk1 n/a
2 TRCN0000040176 GCCTGAGCTTATGAATGCCAA pLKO.1 1078 CDS 100% 2.640 3.696 N SGK1 n/a
3 TRCN0000327644 GCCTGAGCTTATGAATGCCAA pLKO_005 1078 CDS 100% 2.640 3.696 N SGK1 n/a
4 TRCN0000199130 CCCAACGACCTACGGCACTTT pLKO.1 2018 CDS 100% 1.650 2.310 N SGK1 n/a
5 TRCN0000199502 GCCGAGGCTTTCCTAGGCTTT pLKO.1 2126 CDS 100% 1.350 1.890 N SGK1 n/a
6 TRCN0000196562 GCAATCTTATTGCACACTGTT pLKO.1 2304 3UTR 100% 4.950 3.960 N SGK1 n/a
7 TRCN0000312570 GCAATCTTATTGCACACTGTT pLKO_005 2304 3UTR 100% 4.950 3.960 N SGK1 n/a
8 TRCN0000312571 ATTCACTGAACATCGTTTATA pLKO_005 1524 CDS 100% 15.000 10.500 N SGK1 n/a
9 TRCN0000194957 CTGGAAGCTTAGCAATCTTAT pLKO.1 2293 3UTR 100% 13.200 9.240 N SGK1 n/a
10 TRCN0000312569 CTGGAAGCTTAGCAATCTTAT pLKO_005 2293 3UTR 100% 13.200 9.240 N SGK1 n/a
11 TRCN0000196750 GATGACTTCATGGAGATTAAG pLKO.1 1913 CDS 100% 13.200 9.240 N SGK1 n/a
12 TRCN0000199697 CGTCCAATCCTCATGCTAAAC pLKO.1 1146 CDS 100% 10.800 7.560 N SGK1 n/a
13 TRCN0000197034 GTCTTGCAATGACTCGTATTC pLKO.1 2798 3UTR 100% 10.800 7.560 N SGK1 n/a
14 TRCN0000040175 CGGAATGTTCTGTTGAAGAAT pLKO.1 1322 CDS 100% 5.625 3.938 N SGK1 n/a
15 TRCN0000009867 TATGTGTGTTTCCGAATGTTT pLKO.1 2210 3UTR 100% 5.625 3.938 N SGK1 n/a
16 TRCN0000040173 CCTCATCCCATCACACAACTT pLKO.1 3120 3UTR 100% 4.950 3.465 N SGK1 n/a
17 TRCN0000040174 GCTGAAATGTACGACAACATT pLKO.1 1790 CDS 100% 0.563 0.394 N SGK1 n/a
18 TRCN0000009866 GAAATGTACGACAACATTCTG pLKO.1 1793 CDS 100% 0.495 0.347 N SGK1 n/a
19 TRCN0000040177 CATGTCTTCTTCTCCTTAATT pLKO.1 1937 CDS 100% 15.000 9.000 N SGK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01527 pDONR223 100% 80.3% 75.2% None (many diffs) n/a
2 ccsbBroad304_01527 pLX_304 52.3% 80.3% 75.2% V5 (many diffs) n/a
3 TRCN0000467477 GTCCCTAAAGATCAAAATTTACCT pLX_317 37.1% 80.3% 75.2% V5 (many diffs) n/a
4 ccsbBroadEn_14840 pDONR223 0% 80.3% 75.2% None (many diffs) n/a
5 ccsbBroad304_14840 pLX_304 0% 80.3% 75.2% V5 (many diffs) n/a
6 TRCN0000473658 TATATATCTACAATCTCAGAACCC pLX_317 36.7% 80.3% 75% V5 (many diffs) n/a
Download CSV