Transcript: Human NM_001145425.1

Homo sapiens nuclear receptor subfamily 1 group D member 2 (NR1D2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
NR1D2 (9975)
Length:
5066
CDS:
343..1857

Additional Resources:

NCBI RefSeq record:
NM_001145425.1
NBCI Gene record:
NR1D2 (9975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365703 ATGGTACGGTTCGCATCATTA pLKO_005 1456 CDS 100% 13.200 18.480 N NR1D2 n/a
2 TRCN0000365706 GAATGGTGATCTCGCCAATAT pLKO_005 285 5UTR 100% 13.200 18.480 N NR1D2 n/a
3 TRCN0000376665 TCGTGCACTAAGGACCTTAAT pLKO_005 1716 CDS 100% 13.200 18.480 N NR1D2 n/a
4 TRCN0000022193 CGCCAATATTGAAGGCATCTT pLKO.1 297 5UTR 100% 4.950 6.930 N NR1D2 n/a
5 TRCN0000022192 GCCCTCCAACTTAGTGATGAA pLKO.1 1600 CDS 100% 4.950 6.930 N NR1D2 n/a
6 TRCN0000022189 CGCATCATTATTTGATGCAAA pLKO.1 1467 CDS 100% 0.495 0.693 N NR1D2 n/a
7 TRCN0000365778 ATTACTACCACAAGACTATTT pLKO_005 2260 3UTR 100% 13.200 9.240 N NR1D2 n/a
8 TRCN0000365705 TTGCCAGATCTTCGATCTTTA pLKO_005 1789 CDS 100% 13.200 9.240 N NR1D2 n/a
9 TRCN0000022190 CCAATGAGTAAGTCTCCATAT pLKO.1 1270 CDS 100% 10.800 7.560 N NR1D2 n/a
10 TRCN0000370922 GTGGAATTTGCAAAGCGTATT pLKO_005 1366 CDS 100% 10.800 7.560 N NR1D2 n/a
11 TRCN0000022191 CCAGTACAAGAAGTGCCTGAA pLKO.1 522 CDS 100% 4.050 2.835 N NR1D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488448 GACGTTCAGTGGAATCGCTATCCC pLX_317 18.2% 86.9% 87% V5 (not translated due to prior stop codon) 0_1ins225;954T>C n/a
2 TRCN0000489584 CTCCCCAAGTGTGCGCTCTTCCGA pLX_317 18% 86.8% 86.5% V5 (many diffs) n/a
3 ccsbBroadEn_11440 pDONR223 100% 56.3% 52.8% None (many diffs) n/a
4 ccsbBroad304_11440 pLX_304 0% 56.3% 52.8% V5 (many diffs) n/a
5 TRCN0000474337 CAAGAGCTACGATCTACTCCCCCA pLX_317 29.6% 56.3% 52.8% V5 (many diffs) n/a
Download CSV