Transcript: Human NM_001145427.2

Homo sapiens sorting nexin 18 (SNX18), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SNX18 (112574)
Length:
5376
CDS:
195..1970

Additional Resources:

NCBI RefSeq record:
NM_001145427.2
NBCI Gene record:
SNX18 (112574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428108 TCCACGTTCAGAAAGGTAAAG pLKO_005 1801 CDS 100% 10.800 15.120 N SNX18 n/a
2 TRCN0000438604 GAGATGCCTATGACGCCATTG pLKO_005 1684 CDS 100% 6.000 8.400 N SNX18 n/a
3 TRCN0000165479 GAGCAGGTGATATGGAGTGTA pLKO.1 1833 CDS 100% 4.950 3.960 N SNX18 n/a
4 TRCN0000413710 GTGGGTTTCAGAATCATATTC pLKO_005 1895 CDS 100% 13.200 9.240 N SNX18 n/a
5 TRCN0000165480 GAGTGTATTGTGCAGGCTGAA pLKO.1 1847 CDS 100% 4.050 2.835 N SNX18 n/a
6 TRCN0000166133 CTTCATCTCTAAGCGCAGGAA pLKO.1 1235 CDS 100% 2.640 1.848 N SNX18 n/a
7 TRCN0000166645 CCAACTTCTTCCTGACCCTTA pLKO.1 1408 CDS 100% 4.050 2.430 N SNX18 n/a
8 TRCN0000165826 GATCTGGTGGATGAACCACAT pLKO.1 1262 CDS 100% 4.050 2.430 N SNX18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16073 pDONR223 0% 90.5% 83.6% None (many diffs) n/a
2 ccsbBroad304_16073 pLX_304 0% 90.5% 83.6% V5 (many diffs) n/a
3 TRCN0000467806 CGGAATTGGTGCCGATAATAGGAT pLX_317 22% 90.5% 83.6% V5 (many diffs) n/a
Download CSV