Transcript: Human NM_001145524.2

Homo sapiens yippee like 3 (YPEL3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
YPEL3 (83719)
Length:
939
CDS:
184..543

Additional Resources:

NCBI RefSeq record:
NM_001145524.2
NBCI Gene record:
YPEL3 (83719)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243057 CGGATCTAGCTCCTGTATATA pLKO_005 654 3UTR 100% 15.000 21.000 N YPEL3 n/a
2 TRCN0000243056 GAACTCAACCACATGATCAAA pLKO_005 505 CDS 100% 5.625 7.875 N YPEL3 n/a
3 TRCN0000172555 GATGATTGTCACCGGAGGTAT pLKO.1 226 CDS 100% 4.950 3.960 N YPEL3 n/a
4 TRCN0000243055 AGAGCAGCCAGAAGTACAAAG pLKO_005 467 CDS 100% 10.800 7.560 N YPEL3 n/a
5 TRCN0000243053 GAGAACTGCAAGACCACTTTG pLKO_005 421 CDS 100% 10.800 7.560 N YPEL3 n/a
6 TRCN0000243054 TCAGGCCTACTTGGATGATTG pLKO_005 213 CDS 100% 10.800 7.560 N YPEL3 n/a
7 TRCN0000191128 CAACCACATGATCAAAGACAA pLKO.1 510 CDS 100% 4.950 3.465 N Ypel3 n/a
8 TRCN0000277395 CAACCACATGATCAAAGACAA pLKO_005 510 CDS 100% 4.950 3.465 N Ypel3 n/a
9 TRCN0000172387 CAGGCCTACTTGGATGATTGT pLKO.1 214 CDS 100% 4.950 3.465 N YPEL3 n/a
10 TRCN0000166935 GAAGTACATCATTGAACTCAA pLKO.1 492 CDS 100% 4.950 3.465 N YPEL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16023 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16023 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_08123 pDONR223 100% 80.2% 87.3% None (many diffs) n/a
4 ccsbBroad304_08123 pLX_304 0% 80.2% 87.3% V5 (many diffs) n/a
5 TRCN0000472132 TTCAACAATTGAGCCTCATAACTA pLX_317 100% 80.2% 87.3% V5 (many diffs) n/a
6 ccsbBroadEn_12753 pDONR223 100% 59.2% 59.2% None 0_1ins246 n/a
7 ccsbBroad304_12753 pLX_304 0% 59.2% 59.2% V5 0_1ins246 n/a
8 TRCN0000472105 CCTAACTGAAGGGCCTCCGCGATT pLX_317 81.5% 59.2% 59.2% V5 0_1ins246 n/a
Download CSV