Transcript: Mouse NM_001165996.1

Mus musculus muscle, skeletal, receptor tyrosine kinase (Musk), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Musk (18198)
Length:
1747
CDS:
151..1545

Additional Resources:

NCBI RefSeq record:
NM_001165996.1
NBCI Gene record:
Musk (18198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001165996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361387 TGCACAAGACTGCCATATTTA pLKO_005 1489 CDS 100% 15.000 21.000 N Musk n/a
2 TRCN0000023684 GCTACCAATAAGCACGGAGAA pLKO.1 1000 CDS 100% 4.050 3.240 N Musk n/a
3 TRCN0000356283 ACATGCATAGCTACCAATAAG pLKO_005 991 CDS 100% 13.200 9.240 N MUSK n/a
4 TRCN0000361449 ACATGCATAGCTACCAATAAG pLKO_005 991 CDS 100% 13.200 9.240 N Musk n/a
5 TRCN0000023686 CCTGCACAAGACTGCCATATT pLKO.1 1487 CDS 100% 13.200 9.240 N Musk n/a
6 TRCN0000195290 CAAGTGAAGATGAAACCTAAA pLKO.1 496 CDS 100% 10.800 7.560 N MUSK n/a
7 TRCN0000002165 CCAGGACTCTACACATGCATA pLKO.1 979 CDS 100% 4.950 3.465 N MUSK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14704 pDONR223 0% 47.1% 49.1% None (many diffs) n/a
2 ccsbBroad304_14704 pLX_304 0% 47.1% 49.1% V5 (many diffs) n/a
3 ccsbBroadEn_06606 pDONR223 100% 38.3% 39.8% None (many diffs) n/a
4 ccsbBroad304_06606 pLX_304 0% 38.3% 39.8% V5 (many diffs) n/a
5 TRCN0000465498 ACCCGCCCGAGAACTTTAAAAATA pLX_317 15.3% 38.3% 39.8% V5 (many diffs) n/a
Download CSV