Transcript: Human NM_001168280.3

Homo sapiens WW domain containing transcription regulator 1 (WWTR1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
WWTR1 (25937)
Length:
4977
CDS:
205..1407

Additional Resources:

NCBI RefSeq record:
NM_001168280.3
NBCI Gene record:
WWTR1 (25937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019473 CCTGCCGGAGTCTTTCTTTAA pLKO.1 345 CDS 100% 13.200 10.560 N WWTR1 n/a
2 TRCN0000370007 GCGTTCTTGTGACAGATTATA pLKO_005 1627 3UTR 100% 15.000 10.500 N WWTR1 n/a
3 TRCN0000370006 TAAGCTTTATGGGTGTTAATT pLKO_005 1714 3UTR 100% 15.000 10.500 N WWTR1 n/a
4 TRCN0000019471 CAGCCAAATCTCGTGATGAAT pLKO.1 760 CDS 100% 5.625 3.938 N WWTR1 n/a
5 TRCN0000319150 CAGCCAAATCTCGTGATGAAT pLKO_005 760 CDS 100% 5.625 3.938 N WWTR1 n/a
6 TRCN0000019470 CCAGGAACAAACGTTGACTTA pLKO.1 1297 CDS 100% 4.950 3.465 N WWTR1 n/a
7 TRCN0000319224 CCAGGAACAAACGTTGACTTA pLKO_005 1297 CDS 100% 4.950 3.465 N WWTR1 n/a
8 TRCN0000019469 GCGATGAATCAGCCTCTGAAT pLKO.1 676 CDS 100% 4.950 3.465 N WWTR1 n/a
9 TRCN0000319149 GCGATGAATCAGCCTCTGAAT pLKO_005 676 CDS 100% 4.950 3.465 N WWTR1 n/a
10 TRCN0000019472 GCCCTTTCTAACCTGGCTGTA pLKO.1 1386 CDS 100% 4.050 2.835 N WWTR1 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2510 3UTR 100% 5.625 2.813 Y EID2B n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2510 3UTR 100% 5.625 2.813 Y KLHL30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02889 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02889 pLX_304 44.7% 100% 100% V5 n/a
3 TRCN0000472318 CATTTTATCCGAAACCGGTTGTGA pLX_317 40.4% 100% 100% V5 n/a
4 TRCN0000488989 TCGTCCAGGGCTAAACAGCTGTCG pLX_317 25.3% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV