Transcript: Human NM_001193464.2

Homo sapiens dynein cytoplasmic 2 light intermediate chain 1 (DYNC2LI1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
DYNC2LI1 (51626)
Length:
1402
CDS:
101..1159

Additional Resources:

NCBI RefSeq record:
NM_001193464.2
NBCI Gene record:
DYNC2LI1 (51626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121639 GAACCTCTTTATTGGACTTAA pLKO.1 369 CDS 100% 13.200 10.560 N DYNC2LI1 n/a
2 TRCN0000219891 CATGTAGACAAAGTGATAATG pLKO.1 509 CDS 100% 13.200 9.240 N DYNC2LI1 n/a
3 TRCN0000333027 CATGTAGACAAAGTGATAATG pLKO_005 509 CDS 100% 13.200 9.240 N DYNC2LI1 n/a
4 TRCN0000144767 CCAACCTTAGCTTTGGAATAT pLKO.1 278 CDS 100% 13.200 9.240 N DYNC2LI1 n/a
5 TRCN0000344672 CCAACCTTAGCTTTGGAATAT pLKO_005 278 CDS 100% 13.200 9.240 N DYNC2LI1 n/a
6 TRCN0000143826 GTTCTCGTTCTGGATCTTTCA pLKO.1 434 CDS 100% 4.950 3.465 N DYNC2LI1 n/a
7 TRCN0000344673 GTTCTCGTTCTGGATCTTTCA pLKO_005 434 CDS 100% 4.950 3.465 N DYNC2LI1 n/a
8 TRCN0000144957 GAATAATATGCCGAAGGATCA pLKO.1 583 CDS 100% 4.050 2.835 N DYNC2LI1 n/a
9 TRCN0000143492 GATGGAGCTGAAATTGCAGAA pLKO.1 173 CDS 100% 4.050 2.430 N DYNC2LI1 n/a
10 TRCN0000353073 GATGGAGCTGAAATTGCAGAA pLKO_005 173 CDS 100% 4.050 2.430 N DYNC2LI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03348 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03348 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467560 TGTTCAGGGGAATGGGGGAGAGGC pLX_317 30.2% 100% 100% V5 n/a
4 ccsbBroadEn_08331 pDONR223 100% 53.5% 49.2% None (many diffs) n/a
5 ccsbBroad304_08331 pLX_304 0% 53.5% 49.2% V5 (many diffs) n/a
6 TRCN0000468521 TTAAAGCACGCTCGTTGCAGCATA pLX_317 24.5% 53.5% 49.2% V5 (many diffs) n/a
7 TRCN0000470581 GATCAGCATAGCTTTATCCCCTAA pLX_317 69.1% 53.4% 49% V5 (many diffs) n/a
8 ccsbBroadEn_08330 pDONR223 100% 53.4% 48.3% None (many diffs) n/a
9 ccsbBroad304_08330 pLX_304 0% 53.4% 48.3% V5 (many diffs) n/a
10 ccsbBroadEn_15853 pDONR223 0% 39.4% 32.6% None (many diffs) n/a
11 ccsbBroad304_15853 pLX_304 0% 39.4% 32.6% V5 (many diffs) n/a
12 TRCN0000479213 CACCGACTAAAGGCCTGTCTACTT pLX_317 100% 39.4% 32.6% V5 (many diffs) n/a
Download CSV