Transcript: Mouse NM_001198977.1

Mus musculus spleen tyrosine kinase (Syk), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Mus musculus (mouse)
Gene:
Syk (20963)
Length:
5144
CDS:
213..2102

Additional Resources:

NCBI RefSeq record:
NM_001198977.1
NBCI Gene record:
Syk (20963)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148390 CACACCACTACACCATCGAG pXPR_003 AGG 195 10% 2 0.3644 Syk SYK 76776
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234764 GACTATGAATGCCCACTAAAT pLKO_005 4596 3UTR 100% 13.200 18.480 N Syk n/a
2 TRCN0000234760 ACGGTCCTCATAGGGTCAAAG pLKO_005 750 CDS 100% 10.800 15.120 N Syk n/a
3 TRCN0000234763 ACTACGACGTGGTTAACTAAC pLKO_005 2083 CDS 100% 10.800 15.120 N Syk n/a
4 TRCN0000023571 GAGGGAACTTAATGGCACCTA pLKO.1 410 CDS 100% 2.640 3.696 N Syk n/a
5 TRCN0000234761 GAATAATCTCAAGGATCAAAT pLKO_005 1057 CDS 100% 13.200 9.240 N Syk n/a
6 TRCN0000023569 GCAGCAGAACAGGCACATTAA pLKO.1 1574 CDS 100% 13.200 9.240 N Syk n/a
7 TRCN0000234762 GGAACTGAGGCTTCGCAATTA pLKO_005 2060 CDS 100% 13.200 9.240 N Syk n/a
8 TRCN0000023573 GCTAGTGGAACATTACTCTTA pLKO.1 926 CDS 100% 4.950 3.465 N Syk n/a
9 TRCN0000023570 CGAAGGGAAAGTATTGCACTA pLKO.1 836 CDS 100% 4.050 2.835 N Syk n/a
10 TRCN0000023572 GAGAGAGATGTACGACCTGAT pLKO.1 1988 CDS 100% 4.050 2.835 N Syk n/a
11 TRCN0000003166 CGGGTGGAATAATCTCAAGAA pLKO.1 1051 CDS 100% 4.950 3.465 N SYK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07023 pDONR223 100% 84.6% 92.1% None (many diffs) n/a
2 ccsbBroadEn_14855 pDONR223 0% 84.6% 92.1% None (many diffs) n/a
3 TRCN0000469109 GGGACTCATCCGCCACTTACAAAG pLX_317 19.5% 84.6% 92.1% V5 (many diffs) n/a
4 TRCN0000487694 CAAGCTGGTCTTCCAATCGACGTG pLX_317 11.5% 84.6% 92.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_07024 pDONR223 100% 82% 88.8% None (many diffs) n/a
6 ccsbBroad304_07024 pLX_304 24.8% 82% 88.8% V5 (many diffs) n/a
7 TRCN0000473682 GATAATATGCTTGAAGTTGCAACA pLX_317 19.9% 82% 88.8% V5 (many diffs) n/a
8 TRCN0000487794 GACACCTTGAAGTCTTTTATAATT pLX_317 12% 81.9% 88.8% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489533 TTATAACTTTTACCTAAAAGGTTC pLX_317 21.5% 81.9% 88.6% V5 (many diffs) n/a
Download CSV