Transcript: Human NM_001199492.1

Homo sapiens programmed cell death 4 (PDCD4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
PDCD4 (27250)
Length:
3602
CDS:
287..1654

Additional Resources:

NCBI RefSeq record:
NM_001199492.1
NBCI Gene record:
PDCD4 (27250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344656 CGCCCTTAGAAGTGGATTAAC pLKO_005 493 CDS 100% 13.200 18.480 N PDCD4 n/a
2 TRCN0000370330 TTTGAGCATGGAGATACTAAT pLKO_005 770 CDS 100% 13.200 18.480 N PDCD4 n/a
3 TRCN0000059080 CCTCCATTAACGAAGCTAGAA pLKO.1 387 CDS 100% 4.950 6.930 N PDCD4 n/a
4 TRCN0000059079 GCGGTTTGTAGAAGAATGTTT pLKO.1 1525 CDS 100% 5.625 4.500 N PDCD4 n/a
5 TRCN0000333163 GCGGTTTGTAGAAGAATGTTT pLKO_005 1525 CDS 100% 5.625 4.500 N PDCD4 n/a
6 TRCN0000344710 ACAATGAAATTCCGGACATTA pLKO_005 1470 CDS 100% 13.200 9.240 N PDCD4 n/a
7 TRCN0000321156 GGAACTGGAAGTACCTCATTT pLKO_005 1300 CDS 100% 13.200 9.240 N Pdcd4 n/a
8 TRCN0000435341 GGAACTGGAAGTACCTCATTT pLKO_005 1300 CDS 100% 13.200 9.240 N PDCD4 n/a
9 TRCN0000420547 TACAAGGCATTTCTGACATTT pLKO_005 1761 3UTR 100% 13.200 9.240 N PDCD4 n/a
10 TRCN0000419060 ATGTGAAAGATCCTAACTATG pLKO_005 654 CDS 100% 10.800 7.560 N PDCD4 n/a
11 TRCN0000059082 CTACCATTACTGTAGACCAAA pLKO.1 1425 CDS 100% 4.950 3.465 N PDCD4 n/a
12 TRCN0000059081 CTGACCTTTGTGGGACAGTAA pLKO.1 915 CDS 100% 4.950 3.465 N PDCD4 n/a
13 TRCN0000059078 CCTTTGGATGAAAGGGCATTT pLKO.1 716 CDS 100% 1.080 0.756 N PDCD4 n/a
14 TRCN0000344657 CTTGCAGTCTTAGATGTTATA pLKO_005 1666 3UTR 100% 13.200 6.600 Y PDCD4 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3102 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3266 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14123 pDONR223 100% 96.8% 95.9% None (many diffs) n/a
2 ccsbBroad304_14123 pLX_304 0% 96.8% 95.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472554 GTTACTACCGTATGTCTCAGGCAA pLX_317 31.6% 96.8% 95.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV