Transcript: Human NM_001199856.1

Homo sapiens adenylate kinase 3 (AK3), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
AK3 (50808)
Length:
4105
CDS:
205..678

Additional Resources:

NCBI RefSeq record:
NM_001199856.1
NBCI Gene record:
AK3 (50808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148120 ATCCAACAGCCAGCTATACT pXPR_003 GGG 43 9% 2 0.5757 AK3 AK3 76584
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231930 CAGATCGACACAGTGATTAAC pLKO_005 313 CDS 100% 13.200 18.480 N AK3 n/a
2 TRCN0000356571 CAGCGATGTCTGAACCTTTAA pLKO_005 908 3UTR 100% 13.200 18.480 N AK3 n/a
3 TRCN0000356570 GACGGTTATCAAGAGACTAAA pLKO_005 495 CDS 100% 13.200 18.480 N AK3 n/a
4 TRCN0000231933 GCCGTCTTACAAGTCGTTATT pLKO_005 2034 3UTR 100% 13.200 18.480 N AK3 n/a
5 TRCN0000231931 GTGGCCGAGTCTATAACATTG pLKO_005 395 CDS 100% 10.800 15.120 N AK3 n/a
6 TRCN0000220626 GCCCTGATAAATAACAAGTTA pLKO.1 1543 3UTR 100% 5.625 7.875 N AK3 n/a
7 TRCN0000220627 CGACACAGTGATTAACCTGAA pLKO.1 318 CDS 100% 4.050 5.670 N AK3 n/a
8 TRCN0000231932 ATTCAGCGTGAGGATGATAAA pLKO_005 469 CDS 100% 13.200 9.240 N AK3 n/a
9 TRCN0000194924 CACTAGGTTATCAAGCATATA pLKO.1 2322 3UTR 100% 13.200 9.240 N AK3 n/a
10 TRCN0000356497 TATGCTTTCCTACAAACTAAA pLKO_005 619 CDS 100% 13.200 9.240 N AK3 n/a
11 TRCN0000257382 TGTGCCCTTTGAGGTCATTAA pLKO_005 339 CDS 100% 13.200 9.240 N AK3 n/a
12 TRCN0000220630 CCTAGATAGAGCTTATCAGAT pLKO.1 297 CDS 100% 4.950 3.465 N AK3 n/a
13 TRCN0000220628 CGGAACAGAAACCAACAAGAT pLKO.1 585 CDS 100% 4.950 3.465 N AK3 n/a
14 TRCN0000220629 GCTTTCATTGACCAAGGGAAA pLKO.1 166 5UTR 100% 4.050 2.835 N AK3 n/a
15 TRCN0000197249 GATAAACCAGAGACGGTTATC pLKO.1 484 CDS 100% 1.080 0.756 N AK3 n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3155 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3156 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03152 pDONR223 100% 69.1% 69.1% None 0_1ins210 n/a
2 ccsbBroad304_03152 pLX_304 0% 69.1% 69.1% V5 0_1ins210 n/a
3 TRCN0000472819 AAATTGAGAGAAGCTGGCCCGTTT pLX_317 68% 69.1% 69.1% V5 0_1ins210 n/a
4 ccsbBroadEn_15057 pDONR223 0% 69.1% 69.1% None 0_1ins210 n/a
5 ccsbBroad304_15057 pLX_304 0% 69.1% 69.1% V5 0_1ins210 n/a
6 TRCN0000469861 GCCGCTTCATGTGAACTCCGGGCT pLX_317 60.7% 69.1% 69.1% V5 0_1ins210 n/a
7 TRCN0000492274 AGCTCCAGGAGATTATGGCGGCAC pLX_317 65.7% 69.1% 69.1% V5 (not translated due to prior stop codon) 0_1ins210 n/a
Download CSV