Transcript: Human NM_001202423.1

Homo sapiens tRNA methyltransferase 1 like (TRMT1L), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
TRMT1L (81627)
Length:
4029
CDS:
349..2082

Additional Resources:

NCBI RefSeq record:
NM_001202423.1
NBCI Gene record:
TRMT1L (81627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001202423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429019 GATCACCCTACTGCTTAATAA pLKO_005 2330 3UTR 100% 15.000 21.000 N TRMT1L n/a
2 TRCN0000414530 GTCTGTATAGATGGCCTAATA pLKO_005 2109 3UTR 100% 13.200 18.480 N TRMT1L n/a
3 TRCN0000428140 AGACACGGATGTACAAGTTTG pLKO_005 576 CDS 100% 10.800 15.120 N TRMT1L n/a
4 TRCN0000038783 GCAGTCAAAGTTACAATCAAT pLKO.1 778 CDS 100% 5.625 7.875 N TRMT1L n/a
5 TRCN0000038779 GCCCATTATCATTGTATCATT pLKO.1 424 CDS 100% 5.625 7.875 N TRMT1L n/a
6 TRCN0000436462 ACATTGTCCGAACTGAATATT pLKO_005 1139 CDS 100% 15.000 12.000 N TRMT1L n/a
7 TRCN0000435234 ATGTTCTTACAGGTCATAATG pLKO_005 2536 3UTR 100% 13.200 9.240 N TRMT1L n/a
8 TRCN0000038782 CAGACCCTAATAAAGACATTA pLKO.1 1549 CDS 100% 13.200 9.240 N TRMT1L n/a
9 TRCN0000436270 GAATAAAGGAGAGACTAAATC pLKO_005 501 CDS 100% 13.200 9.240 N TRMT1L n/a
10 TRCN0000430861 TTGGAACATCAGTGAATTATC pLKO_005 1004 CDS 100% 13.200 9.240 N TRMT1L n/a
11 TRCN0000038780 GCAGCTAATATTCTGTACATT pLKO.1 660 CDS 100% 5.625 3.938 N TRMT1L n/a
12 TRCN0000038781 CCAGCTCATTGAACTCAGATA pLKO.1 194 5UTR 100% 4.950 2.970 N TRMT1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001202423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04250 pDONR223 100% 78.7% 78.7% None 0_1ins468 n/a
2 ccsbBroad304_04250 pLX_304 0% 78.7% 78.7% V5 0_1ins468 n/a
3 TRCN0000491498 CGCCAGCAGACATGCGTCGCACAT pLX_317 14.3% 78.7% 78.7% V5 0_1ins468 n/a
Download CSV