Transcript: Human NM_001206671.4

Homo sapiens RIC3 acetylcholine receptor chaperone (RIC3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
RIC3 (79608)
Length:
5788
CDS:
37..1146

Additional Resources:

NCBI RefSeq record:
NM_001206671.4
NBCI Gene record:
RIC3 (79608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206671.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135792 CCTGGTGAGAAGAGAACATTT pLKO.1 1604 3UTR 100% 13.200 9.240 N RIC3 n/a
2 TRCN0000136657 GCTACATCAGCTCCGAGAAAT pLKO.1 597 CDS 100% 13.200 9.240 N RIC3 n/a
3 TRCN0000136176 GCCAGTCTGAAGTATCCATTA pLKO.1 1152 3UTR 100% 10.800 7.560 N RIC3 n/a
4 TRCN0000134662 GCTGAAAGAATGGGAATGATA pLKO.1 820 CDS 100% 5.625 3.938 N RIC3 n/a
5 TRCN0000135017 CCCAGGAAGATAATTCTGTTA pLKO.1 896 CDS 100% 4.950 3.465 N RIC3 n/a
6 TRCN0000135191 CCTGGATATCTAGCTTCCTTT pLKO.1 1820 3UTR 100% 4.950 3.465 N RIC3 n/a
7 TRCN0000136958 CCAAGAGAAACGGTTGCTACA pLKO.1 582 CDS 100% 4.050 2.835 N RIC3 n/a
8 TRCN0000134585 GAAGAGGAAGAATCAGATCAT pLKO.1 841 CDS 100% 4.950 2.970 N RIC3 n/a
9 TRCN0000135599 GCCCAGGAAGATAATTCTGTT pLKO.1 895 CDS 100% 4.950 2.970 N RIC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206671.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489052 ACCCTCTTGCATGCCTGCACGGGG pLX_317 32.6% 99.7% 99.7% V5 (not translated due to prior stop codon) 520_522delAGC n/a
2 TRCN0000488694 TTCTCCCTGACTACGATACCCGTC pLX_317 32.7% 99.4% 68.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_08936 pDONR223 100% 99.3% 99.1% None (many diffs) n/a
4 ccsbBroad304_08936 pLX_304 0% 99.3% 99.1% V5 (many diffs) n/a
5 TRCN0000469413 AAACCCGTTCCAAACCATGTGTCA pLX_317 39.7% 99.3% 99.1% V5 (many diffs) n/a
Download CSV