Transcript: Human NM_001251917.2

Homo sapiens RAP1B, member of RAS oncogene family (RAP1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
RAP1B (5908)
Length:
13261
CDS:
181..609

Additional Resources:

NCBI RefSeq record:
NM_001251917.2
NBCI Gene record:
RAP1B (5908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284747 TATGACCTAGTGCGGCAAATT pLKO_005 529 CDS 100% 13.200 18.480 N RAP1BL n/a
2 TRCN0000029176 GAGAACAGATTCTTCGAGTTA pLKO.1 344 CDS 100% 4.950 6.930 N RAP1B n/a
3 TRCN0000429265 TAGGGAAGGAACAAGGTCAAA pLKO_005 431 CDS 100% 4.950 3.960 N RAP1B n/a
4 TRCN0000272396 AGTCCAAAGAGCTCCTATATA pLKO_005 1010 3UTR 100% 15.000 10.500 N RAP1BL n/a
5 TRCN0000423776 TCATGTCAGCTGCTTTAATAT pLKO_005 592 CDS 100% 15.000 10.500 N RAP1B n/a
6 TRCN0000272395 AGTCCACATTTAACGATTTAC pLKO_005 314 CDS 100% 13.200 9.240 N RAP1BL n/a
7 TRCN0000425086 GGCGGATGAAAGCTACTATAT pLKO_005 740 3UTR 100% 13.200 9.240 N RAP1B n/a
8 TRCN0000029174 CCAATGATTCTTGTTGGTAAT pLKO.1 382 CDS 100% 10.800 7.560 N RAP1B n/a
9 TRCN0000414982 CAATGGAACAACTGTGCATTC pLKO_005 463 CDS 100% 6.000 4.200 N RAP1B n/a
10 TRCN0000029178 AGTGCGGCAAATTAACAGAAA pLKO.1 537 CDS 100% 4.950 3.465 N RAP1B n/a
11 TRCN0000102735 CGCTTTGATTAACACAGCTAT pLKO.1 1123 3UTR 100% 4.950 3.465 N Rap1b n/a
12 TRCN0000272334 TTACAGCAATGAGGGATTTAT pLKO_005 245 CDS 100% 15.000 7.500 Y RAP1BL n/a
13 TRCN0000139826 CCTCCTGAATAGCTGGGATTA pLKO.1 4543 3UTR 100% 10.800 5.400 Y SYNPO2 n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 10900 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 10900 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 11550 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 12291 3UTR 100% 10.800 5.400 Y SMIM11A n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4680 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7468 3UTR 100% 5.625 2.813 Y EID2B n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 10898 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 10898 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 10898 3UTR 100% 4.950 2.475 Y P3H4 n/a
23 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 11389 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
24 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 11065 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01374 pDONR223 100% 62.9% 72.8% None (many diffs) n/a
2 ccsbBroad304_01374 pLX_304 0% 62.9% 72.8% V5 (many diffs) n/a
3 TRCN0000469486 TGTTACCAGGTTATACAGAGCGCG pLX_317 78.4% 62.7% 70.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV