Transcript: Mouse NM_001252192.1

Mus musculus EYA transcriptional coactivator and phosphatase 1 (Eya1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Eya1 (14048)
Length:
4238
CDS:
580..2256

Additional Resources:

NCBI RefSeq record:
NM_001252192.1
NBCI Gene record:
Eya1 (14048)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366166 TCTGTACTTCGCTACTTATTT pLKO_005 2712 3UTR 100% 15.000 21.000 N Eya1 n/a
2 TRCN0000029845 CCGGACGAACTGTGTGAATAT pLKO.1 1950 CDS 100% 13.200 18.480 N Eya1 n/a
3 TRCN0000366228 AGTCCTTCCACACCCATTAAA pLKO_005 1321 CDS 100% 15.000 12.000 N Eya1 n/a
4 TRCN0000366164 ACCACGTCATCAGGATTATAT pLKO_005 1045 CDS 100% 15.000 10.500 N Eya1 n/a
5 TRCN0000029847 CCACGTCATCAGGATTATATT pLKO.1 1046 CDS 100% 15.000 10.500 N Eya1 n/a
6 TRCN0000374710 TGCAGCCACCAGTGCTAATTT pLKO_005 1710 CDS 100% 15.000 10.500 N Eya1 n/a
7 TRCN0000374778 ACAGCAGCAGACGGGTCTTTA pLKO_005 643 CDS 100% 13.200 9.240 N Eya1 n/a
8 TRCN0000366165 CTTCCGCTACAGACGAGTAAA pLKO_005 1782 CDS 100% 13.200 9.240 N Eya1 n/a
9 TRCN0000029844 GATGTACCAATTTCAGCATAT pLKO.1 2347 3UTR 100% 10.800 7.560 N Eya1 n/a
10 TRCN0000374711 TTCGGCAAATGTGATACAAAC pLKO_005 2571 3UTR 100% 10.800 7.560 N Eya1 n/a
11 TRCN0000029846 CCTCACAAACTATGGCTGCAT pLKO.1 782 CDS 100% 2.640 1.848 N Eya1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06185 pDONR223 100% 84.7% 89.8% None (many diffs) n/a
2 ccsbBroad304_06185 pLX_304 0% 84.7% 89.8% V5 (many diffs) n/a
3 TRCN0000473328 TCGCTGCCATAGAGTGCTCGAAGA pLX_317 23.9% 84.7% 89.8% V5 (many diffs) n/a
4 ccsbBroadEn_10813 pDONR223 100% 82.8% 85.8% None (many diffs) n/a
5 ccsbBroad304_10813 pLX_304 0% 82.8% 85.8% V5 (many diffs) n/a
6 TRCN0000478121 CATCTAAAGTACTTAAGGTCTCCA pLX_317 12.8% 82.8% 85.8% V5 (many diffs) n/a
Download CSV