Transcript: Mouse NM_001252448.1

Mus musculus STE20-related kinase adaptor alpha (Strada), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Strada (72149)
Length:
2543
CDS:
183..1478

Additional Resources:

NCBI RefSeq record:
NM_001252448.1
NBCI Gene record:
Strada (72149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025329 GCCACCTTCATCGCAGATAAT pLKO.1 585 CDS 100% 13.200 18.480 N Strada n/a
2 TRCN0000276693 GCCACCTTCATCGCAGATAAT pLKO_005 585 CDS 100% 13.200 18.480 N Strada n/a
3 TRCN0000025332 CCACTCAGATGCTGCTAGAAA pLKO.1 1033 CDS 100% 5.625 7.875 N Strada n/a
4 TRCN0000025330 GCAGCAACCTTAGCATGATTA pLKO.1 826 CDS 100% 13.200 9.240 N Strada n/a
5 TRCN0000276631 GCAGCAACCTTAGCATGATTA pLKO_005 826 CDS 100% 13.200 9.240 N Strada n/a
6 TRCN0000276696 ATCTTCGGCCTGGTGACAAAC pLKO_005 1422 CDS 100% 10.800 7.560 N Strada n/a
7 TRCN0000276695 CTGAGCACCAGGTCAGTTAAG pLKO_005 1941 3UTR 100% 10.800 7.560 N Strada n/a
8 TRCN0000276630 TGAATTTAGCCAGGTACAAAC pLKO_005 436 CDS 100% 10.800 7.560 N Strada n/a
9 TRCN0000025333 CCATCCCAATATAGTACCGTA pLKO.1 560 CDS 100% 2.640 1.848 N Strada n/a
10 TRCN0000025331 CGTCACATCATTTATGGCGTA pLKO.1 617 CDS 100% 2.160 1.512 N Strada n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487854 GAATGTCTAGGATGTCATATAACA pLX_317 21.7% 81.9% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488716 GGTCGCGAGCCGTTCCGTTTAGGT pLX_317 17.8% 62.4% 81.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491266 TCCCTCTTGAAAGCGGACAAACCA pLX_317 13.9% 62.4% 81.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12979 pDONR223 100% 47% 51% None (many diffs) n/a
5 ccsbBroad304_12979 pLX_304 0% 47% 51% V5 (many diffs) n/a
6 TRCN0000471765 ATCATTTCTTACTGCGCAAGTCCT pLX_317 64.4% 47% 51% V5 (many diffs) n/a
7 ccsbBroadEn_15217 pDONR223 0% 47% 51% None (many diffs) n/a
8 ccsbBroad304_15217 pLX_304 0% 47% 51% V5 (many diffs) n/a
9 TRCN0000481363 CTTCCTGGCGGTTGGATTAAAATA pLX_317 70.2% 47% 51% V5 (many diffs) n/a
Download CSV