Transcript: Mouse NM_001253695.1

Mus musculus zinc finger protein 219 (Zfp219), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Zfp219 (69890)
Length:
2782
CDS:
137..2317

Additional Resources:

NCBI RefSeq record:
NM_001253695.1
NBCI Gene record:
Zfp219 (69890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304602 GAAAGCGCTTCCGATTCAATT pLKO_005 336 CDS 100% 13.200 18.480 N Zfp219 n/a
2 TRCN0000304649 AGGAGTGATTAGCTTAGTAAG pLKO_005 2329 3UTR 100% 10.800 15.120 N Zfp219 n/a
3 TRCN0000071330 CTGGTTTCTCAAGGGTCACAT pLKO.1 1003 CDS 100% 4.950 3.465 N Zfp219 n/a
4 TRCN0000302170 CTGGTTTCTCAAGGGTCACAT pLKO_005 1003 CDS 100% 4.950 3.465 N Zfp219 n/a
5 TRCN0000071332 GCGGCTACATCTACGCCTGAA pLKO.1 806 CDS 100% 1.350 0.945 N Zfp219 n/a
6 TRCN0000302169 GCGGCTACATCTACGCCTGAA pLKO_005 806 CDS 100% 1.350 0.945 N Zfp219 n/a
7 TRCN0000071331 CTCAAGTATCACCTTCAGCGT pLKO.1 1766 CDS 100% 0.660 0.462 N Zfp219 n/a
8 TRCN0000302246 CTCAAGTATCACCTTCAGCGT pLKO_005 1766 CDS 100% 0.660 0.462 N Zfp219 n/a
9 TRCN0000016148 GCCAGAGCTTTACACAGTCTT pLKO.1 984 CDS 100% 4.950 3.465 N ZNF219 n/a
10 TRCN0000329983 GCCAGAGCTTTACACAGTCTT pLKO_005 984 CDS 100% 4.950 3.465 N ZNF219 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15832 pDONR223 0% 82.5% 87.9% None (many diffs) n/a
2 ccsbBroad304_15832 pLX_304 0% 82.5% 87.9% V5 (many diffs) n/a
3 TRCN0000475181 TTATCTCTCAACAGCCTCAATAGC pLX_317 17.7% 82.5% 87.9% V5 (many diffs) n/a
4 ccsbBroadEn_08255 pDONR223 100% 82.4% 87.5% None (many diffs) n/a
5 ccsbBroad304_08255 pLX_304 0% 82.4% 87.5% V5 (many diffs) n/a
6 TRCN0000472416 ACTACCACGATGTTCCTCGAGGGT pLX_317 15.1% 82.4% 87.5% V5 (many diffs) n/a
Download CSV