Transcript: Human NM_001258300.1

Homo sapiens shootin 1 (SHTN1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-01-27
Taxon:
Homo sapiens (human)
Gene:
SHTN1 (57698)
Length:
2190
CDS:
469..1965

Additional Resources:

NCBI RefSeq record:
NM_001258300.1
NBCI Gene record:
SHTN1 (57698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062751 CGAAAGAAAGCAGAGTCATTT pLKO.1 970 CDS 100% 13.200 9.240 N SHTN1 n/a
2 TRCN0000286928 CGAAAGAAAGCAGAGTCATTT pLKO_005 970 CDS 100% 13.200 9.240 N SHTN1 n/a
3 TRCN0000294283 GAACGAGATGAAGCCGTTAAA pLKO_005 418 5UTR 100% 13.200 9.240 N SHTN1 n/a
4 TRCN0000062749 CGAAGACAAAGCCAGAATCTT pLKO.1 1583 CDS 100% 5.625 3.938 N SHTN1 n/a
5 TRCN0000062752 CGAGATCAAATTGTATCTGTT pLKO.1 730 CDS 100% 4.950 3.465 N SHTN1 n/a
6 TRCN0000071709 GCACAAGAGATGTTCATTGAA pLKO.1 991 CDS 100% 5.625 3.938 N Shtn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12395 pDONR223 100% 89.2% 89.2% None 0_1ins180 n/a
2 ccsbBroad304_12395 pLX_304 0% 89.2% 89.2% V5 0_1ins180 n/a
3 TRCN0000492086 TAAAATCTGCCCGTAGTTAATCAG pLX_317 26.8% 89.2% 89.2% V5 0_1ins180 n/a
4 ccsbBroadEn_12394 pDONR223 100% 9% 9.1% None 1_1338del;1494_1494delAins220 n/a
5 ccsbBroad304_12394 pLX_304 0% 9% 9.1% V5 1_1338del;1494_1494delAins220 n/a
6 TRCN0000469471 ATTTTATTATCGAGGAAGTGACGT pLX_317 93.9% 9% 9.1% V5 1_1338del;1494_1494delAins220 n/a
Download CSV