Transcript: Human NM_001261841.2

Homo sapiens transmembrane channel like 5 (TMC5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TMC5 (79838)
Length:
4685
CDS:
518..3538

Additional Resources:

NCBI RefSeq record:
NM_001261841.2
NBCI Gene record:
TMC5 (79838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222748 CGTTTATTACCTGGCTGAGTA pLKO.1 2425 CDS 100% 4.950 6.930 N TMC5 n/a
2 TRCN0000068913 GCTAATCATCACCTATCTTTA pLKO.1 3262 CDS 100% 13.200 9.240 N Tmc5 n/a
3 TRCN0000078103 CCTGCATTTATTTGTGACTTT pLKO.1 4000 3UTR 100% 4.950 3.465 N TMC5 n/a
4 TRCN0000289353 CCTGCATTTATTTGTGACTTT pLKO_005 4000 3UTR 100% 4.950 3.465 N TMC5 n/a
5 TRCN0000078104 CCTTTCGTTGTGTCCTGCATT pLKO.1 2498 CDS 100% 4.950 3.465 N TMC5 n/a
6 TRCN0000289287 CCTTTCGTTGTGTCCTGCATT pLKO_005 2498 CDS 100% 4.950 3.465 N TMC5 n/a
7 TRCN0000078105 GCCTGTCGGAAATTCTGAATT pLKO.1 1776 CDS 100% 0.000 0.000 N TMC5 n/a
8 TRCN0000289286 GCCTGTCGGAAATTCTGAATT pLKO_005 1776 CDS 100% 0.000 0.000 N TMC5 n/a
9 TRCN0000078107 CCAGCTCACTTGTTCTGGAAA pLKO.1 3414 CDS 100% 4.950 2.970 N TMC5 n/a
10 TRCN0000289354 CCAGCTCACTTGTTCTGGAAA pLKO_005 3414 CDS 100% 4.950 2.970 N TMC5 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4536 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14272 pDONR223 100% 71.4% 63.2% None (many diffs) n/a
2 ccsbBroad304_14272 pLX_304 0% 71.4% 63.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000491322 GACTTGCGCCGCTCCAACTCGGGC pLX_317 14% 71.4% 63.2% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_12628 pDONR223 100% 64.2% 64.2% None 1_1077del;1640T>C n/a
5 ccsbBroad304_12628 pLX_304 0% 64.2% 64.2% V5 1_1077del;1640T>C n/a
6 TRCN0000478551 GTTTATTGTGAGATATCGAATTCC pLX_317 11.3% 64.2% 64.2% V5 1_1077del;1640T>C n/a
Download CSV