Transcript: Human NM_001270408.2

Homo sapiens junctional adhesion molecule 2 (JAM2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
JAM2 (58494)
Length:
1772
CDS:
565..1503

Additional Resources:

NCBI RefSeq record:
NM_001270408.2
NBCI Gene record:
JAM2 (58494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412465 TAGAGTACCAAGAGGCTATTT pLKO_005 686 CDS 100% 13.200 9.240 N JAM2 n/a
2 TRCN0000422911 TCATCTAAAGCCACGACAATG pLKO_005 1399 CDS 100% 10.800 7.560 N JAM2 n/a
3 TRCN0000057847 GCTCAGAGGAAAGGCTACTTT pLKO.1 1345 CDS 100% 5.625 3.938 N JAM2 n/a
4 TRCN0000057845 GCTCATACACAATGAATACAA pLKO.1 1127 CDS 100% 5.625 3.938 N JAM2 n/a
5 TRCN0000057846 GAAGACTGTTTCCTCCAGATT pLKO.1 726 CDS 100% 4.950 3.465 N JAM2 n/a
6 TRCN0000057843 GCTCCTGAATACACATGGTTT pLKO.1 1051 CDS 100% 4.950 3.465 N JAM2 n/a
7 TRCN0000057844 GCTGAGATGATAGATTTCAAT pLKO.1 823 CDS 100% 5.625 3.375 N JAM2 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1442 CDS 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1443 CDS 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03863 pDONR223 100% 94.1% 89.7% None (many diffs) n/a
2 ccsbBroad304_03863 pLX_304 0% 94.1% 89.7% V5 (many diffs) n/a
3 TRCN0000492227 TCGTCATTTCGGGTGCGGCCTGCA pLX_317 49% 94.1% 89.7% V5 (many diffs) n/a
Download CSV