Transcript: Human NM_001270411.2

Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3B (APOBEC3B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
APOBEC3B (9582)
Length:
1515
CDS:
108..1181

Additional Resources:

NCBI RefSeq record:
NM_001270411.2
NBCI Gene record:
APOBEC3B (9582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140314 CCAGACCTACTTGTGCTATGA pLKO.1 743 CDS 100% 4.950 3.960 N APOBEC3B n/a
2 TRCN0000140731 GACCTACTTGTGCTATGAGGT pLKO.1 746 CDS 100% 2.640 2.112 N APOBEC3B n/a
3 TRCN0000139463 CCTGATGGATCCAGACACATT pLKO.1 680 CDS 100% 4.950 3.465 N APOBEC3B n/a
4 TRCN0000139402 CCAGGTGTATTTCAAGCCTCA pLKO.1 278 CDS 100% 2.160 1.512 N APOBEC3B n/a
5 TRCN0000142875 CCTTGGTACAAATTCGATGAA pLKO.1 615 CDS 100% 4.950 2.475 Y APOBEC3B n/a
6 TRCN0000140591 GCGGATGTATCGAGACACATT pLKO.1 137 CDS 100% 4.950 2.475 Y APOBEC3B n/a
7 TRCN0000156754 GCGGATGTATCGAGACACATT pLKO.1 137 CDS 100% 4.950 2.475 Y APOBEC3D n/a
8 TRCN0000140546 GCAAAGCAATGTGCTCCTGAT pLKO.1 1302 3UTR 100% 4.050 2.025 Y APOBEC3B n/a
9 TRCN0000140811 GCACGCTAAAGGAGATTCTCA pLKO.1 655 CDS 100% 3.000 1.500 Y APOBEC3B n/a
10 TRCN0000140051 CCAAGTCTCCATCATGACCTA pLKO.1 1025 CDS 100% 2.640 1.320 Y APOBEC3B n/a
11 TRCN0000157469 GCTCAAATCTCCTTTGGGACA pLKO.1 241 CDS 100% 2.160 1.080 Y APOBEC3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11391 pDONR223 100% 68.2% 54.5% None (many diffs) n/a
2 ccsbBroad304_11391 pLX_304 0% 68.2% 54.5% V5 (many diffs) n/a
3 TRCN0000473426 GTTAGAAGAAACTTATTTCCATTA pLX_317 28.8% 68.2% 54.5% V5 (many diffs) n/a
4 ccsbBroadEn_05186 pDONR223 100% 41.9% 38.2% None (many diffs) n/a
5 ccsbBroad304_05186 pLX_304 0% 41.9% 38.2% V5 (many diffs) n/a
Download CSV