Transcript: Human NM_001270519.1

Homo sapiens large tumor suppressor kinase 1 (LATS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
LATS1 (9113)
Length:
2743
CDS:
549..2621

Additional Resources:

NCBI RefSeq record:
NM_001270519.1
NBCI Gene record:
LATS1 (9113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199713 GCGAAGGGAATCTCGTATTCA pLKO.1 2423 CDS 100% 5.625 7.875 N LATS1 n/a
2 TRCN0000196748 GATTACAACTTCACCTATTAC pLKO.1 2375 CDS 100% 13.200 9.240 N LATS1 n/a
3 TRCN0000001779 CAAGTCAGAAATCCACCCAAA pLKO.1 738 CDS 100% 4.050 2.835 N LATS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11336 pDONR223 100% 99.9% 100% None 1446T>C n/a
2 ccsbBroad304_11336 pLX_304 0% 99.9% 100% V5 1446T>C n/a
3 TRCN0000470200 GCACGCCCAACACTTTTACGTCTA pLX_317 18.8% 99.9% 100% V5 1446T>C n/a
4 ccsbBroadEn_14930 pDONR223 0% 99.9% 100% None 1446T>C n/a
5 ccsbBroad304_14930 pLX_304 0% 99.9% 100% V5 1446T>C n/a
6 TRCN0000472788 ACCGTGTACAGCAGCTCTCGGTAC pLX_317 23% 99.9% 100% V5 1446T>C n/a
7 TRCN0000488803 CAAGTTGGGTTCATTTCCAAGGGG pLX_317 8% 60.3% 59.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_11335 pDONR223 100% 18.5% 17% None (many diffs) n/a
9 ccsbBroad304_11335 pLX_304 0% 18.5% 17% V5 (many diffs) n/a
10 TRCN0000466560 AATTGTCACGAACTTAATCGTTTC pLX_317 86.3% 18.5% 17% V5 (many diffs) n/a
Download CSV