Transcript: Human NM_001271834.1

Homo sapiens arginine and serine rich coiled-coil 1 (RSRC1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
RSRC1 (51319)
Length:
1566
CDS:
149..979

Additional Resources:

NCBI RefSeq record:
NM_001271834.1
NBCI Gene record:
RSRC1 (51319)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130228 CGAGGGAAATCCTATAGAGTT pLKO.1 416 CDS 100% 4.950 3.960 N RSRC1 n/a
2 TRCN0000281074 CGAGGGAAATCCTATAGAGTT pLKO_005 416 CDS 100% 4.950 3.960 N RSRC1 n/a
3 TRCN0000128605 CCTCGTTCACATTCTTATGAT pLKO.1 317 CDS 100% 5.625 3.938 N RSRC1 n/a
4 TRCN0000281075 CCTCGTTCACATTCTTATGAT pLKO_005 317 CDS 100% 5.625 3.938 N RSRC1 n/a
5 TRCN0000124888 GCAGACATTCAGATCAAGTAA pLKO.1 700 CDS 100% 5.625 3.938 N Rsrc1 n/a
6 TRCN0000128437 GCAGACATTCAGATCAAGTAA pLKO.1 700 CDS 100% 5.625 3.938 N RSRC1 n/a
7 TRCN0000281011 GCAGACATTCAGATCAAGTAA pLKO_005 700 CDS 100% 5.625 3.938 N RSRC1 n/a
8 TRCN0000128413 GATTTCATCTTCCGTATGGTA pLKO.1 1359 3UTR 100% 3.000 2.100 N RSRC1 n/a
9 TRCN0000281010 GATTTCATCTTCCGTATGGTA pLKO_005 1359 3UTR 100% 3.000 2.100 N RSRC1 n/a
10 TRCN0000128628 CACTAGTGTTTCTTAGTGCAA pLKO.1 1252 3UTR 100% 0.000 0.000 N RSRC1 n/a
11 TRCN0000128586 GTCAGCAGTAACATTGGAAAT pLKO.1 1007 3UTR 100% 10.800 6.480 N RSRC1 n/a
12 TRCN0000281073 GTCAGCAGTAACATTGGAAAT pLKO_005 1007 3UTR 100% 10.800 6.480 N RSRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15837 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15837 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473767 CCCCACCGGGTTAAATCTTCCTCC pLX_317 10.8% 100% 100% V5 n/a
4 ccsbBroadEn_03283 pDONR223 100% 82.6% 82.6% None 319_320ins174 n/a
5 ccsbBroad304_03283 pLX_304 0% 82.6% 82.6% V5 319_320ins174 n/a
6 TRCN0000465673 AAAGGGTATCAGTCACCATAACAA pLX_317 29.2% 82.6% 82.6% V5 319_320ins174 n/a
Download CSV