Transcript: Human NM_001280794.2

Homo sapiens EPH receptor B6 (EPHB6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
EPHB6 (2051)
Length:
4008
CDS:
1618..3807

Additional Resources:

NCBI RefSeq record:
NM_001280794.2
NBCI Gene record:
EPHB6 (2051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145223 TGAGAGCCGAGTGTTAGTGG pXPR_003 GGG 463 21% 8 0.8772 EPHB6 EPHB6 77272
2 BRDN0001146592 AATAGACTTTGCCCCCGTAG pXPR_003 GGG 836 38% 10 0.3074 EPHB6 EPHB6 77273
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001280794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235454 TTAGAGGTGCAGGCTGTTAAT pLKO_005 2113 CDS 100% 13.200 18.480 N EPHB6 n/a
2 TRCN0000235453 GACTGCAACTGAACGTCAAAG pLKO_005 1313 5UTR 100% 10.800 15.120 N EPHB6 n/a
3 TRCN0000235452 GAATGACGATACCCGTGACTC pLKO_005 3808 CDS 100% 4.050 5.670 N EPHB6 n/a
4 TRCN0000002016 CTTTGGGATACTCATGTGGGA pLKO.1 3279 CDS 100% 0.660 0.924 N EPHB6 n/a
5 TRCN0000010676 GCTCTTCAATGTCGTGTGCAA pLKO.1 1944 CDS 100% 2.640 2.112 N EPHB6 n/a
6 TRCN0000010677 ATGTGGGAAGTGATGAGTTAT pLKO.1 3292 CDS 100% 13.200 9.240 N EPHB6 n/a
7 TRCN0000235451 GAGTGAGCAGGAGGTACTAAA pLKO_005 3336 CDS 100% 13.200 9.240 N EPHB6 n/a
8 TRCN0000235455 ACTATCAGCTCCGCTACTATG pLKO_005 2300 CDS 100% 10.800 7.560 N EPHB6 n/a
9 TRCN0000199247 CCGGGAGACCTTCACCCTTTA pLKO.1 1110 5UTR 100% 3.600 2.520 N EPHB6 n/a
10 TRCN0000002018 CACATTCGACTCCACTTCTCT pLKO.1 1048 5UTR 100% 3.000 2.100 N EPHB6 n/a
11 TRCN0000199164 CCCTGGACACTGGTCCGAGAA pLKO.1 3831 3UTR 100% 0.000 0.000 N EPHB6 n/a
12 TRCN0000002017 TATTTCCAGACACTTCCTCAA pLKO.1 2467 CDS 100% 4.050 2.430 N EPHB6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001280794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10805 pDONR223 100% 99.8% 99.8% None 94G>T;894A>G;1011A>G n/a
2 ccsbBroad304_10805 pLX_304 0% 99.8% 99.8% V5 94G>T;894A>G;1011A>G n/a
3 TRCN0000470948 TATCCTAGATGCTGATGGGATATC pLX_317 18.7% 99.8% 99.8% V5 94G>T;894A>G;1011A>G n/a
4 ccsbBroadEn_14630 pDONR223 0% 71.3% 71.3% None (many diffs) n/a
5 ccsbBroad304_14630 pLX_304 0% 71.3% 71.3% V5 (many diffs) n/a
6 TRCN0000481066 ACATACGAGACCCATCCACGAAGA pLX_317 11.6% 71.3% 71.3% V5 (many diffs) n/a
Download CSV