Transcript: Human NM_001282715.1

Homo sapiens olfactomedin like 2A (OLFML2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-28
Taxon:
Homo sapiens (human)
Gene:
OLFML2A (169611)
Length:
5970
CDS:
175..1491

Additional Resources:

NCBI RefSeq record:
NM_001282715.1
NBCI Gene record:
OLFML2A (169611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203342 CTATGTCACCAACTACTACTA pLKO.1 819 CDS 100% 4.950 6.930 N OLFML2A n/a
2 TRCN0000186403 CCTCAAATTCAGAGAGCTTAA pLKO.1 5589 3UTR 100% 10.800 7.560 N OLFML2A n/a
3 TRCN0000312450 CCTCAAATTCAGAGAGCTTAA pLKO_005 5589 3UTR 100% 10.800 7.560 N OLFML2A n/a
4 TRCN0000203930 CCGCCAAACAAACATTCACTA pLKO.1 3942 3UTR 100% 4.950 3.465 N OLFML2A n/a
5 TRCN0000349717 CCGCCAAACAAACATTCACTA pLKO_005 3942 3UTR 100% 4.950 3.465 N OLFML2A n/a
6 TRCN0000204364 CGCCTTCACCAAGAACATCAT pLKO.1 972 CDS 100% 4.950 3.465 N OLFML2A n/a
7 TRCN0000203509 CTTCACCAAGAACATCATCAA pLKO.1 975 CDS 100% 4.950 3.465 N OLFML2A n/a
8 TRCN0000312449 CTTCACCAAGAACATCATCAA pLKO_005 975 CDS 100% 4.950 3.465 N OLFML2A n/a
9 TRCN0000186926 GATCTATGTCACCAACTACTA pLKO.1 816 CDS 100% 4.950 3.465 N OLFML2A n/a
10 TRCN0000312441 GATCTATGTCACCAACTACTA pLKO_005 816 CDS 100% 4.950 3.465 N OLFML2A n/a
11 TRCN0000188447 CGACAGGATCTATGTCACCAA pLKO.1 810 CDS 100% 2.640 1.848 N OLFML2A n/a
12 TRCN0000189065 GACATCAGCAAGTATGGCAGT pLKO.1 226 CDS 100% 2.160 1.296 N OLFML2A n/a
13 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3494 3UTR 100% 1.080 0.540 Y GPR83 n/a
14 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3494 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13354 pDONR223 100% 99.9% 99.7% None 283A>G n/a
2 ccsbBroad304_13354 pLX_304 0% 99.9% 99.7% V5 283A>G n/a
3 TRCN0000478432 ACTTAGCTGCTCTTCCCATTTTTA pLX_317 23.9% 99.9% 99.7% V5 283A>G n/a
Download CSV