Transcript: Human NM_001282774.2

Homo sapiens RNA polymerase I subunit B (POLR1B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
POLR1B (84172)
Length:
6978
CDS:
31..2889

Additional Resources:

NCBI RefSeq record:
NM_001282774.2
NBCI Gene record:
POLR1B (84172)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434292 GACGATGGATTGCCGTTTATA pLKO_005 1906 CDS 100% 15.000 21.000 N POLR1B n/a
2 TRCN0000429702 TTATCAGCGCTTACGCCATAT pLKO_005 2475 CDS 100% 10.800 15.120 N POLR1B n/a
3 TRCN0000423561 GAACCCAACTATCGGAGATAA pLKO_005 2106 CDS 100% 13.200 10.560 N POLR1B n/a
4 TRCN0000414251 TTATAGCCACGTTGAAGTAAA pLKO_005 3290 3UTR 100% 13.200 10.560 N POLR1B n/a
5 TRCN0000434272 TATCAAGACCGATCGGATAAC pLKO_005 1588 CDS 100% 10.800 8.640 N POLR1B n/a
6 TRCN0000052918 CCCTCCATGTATGATTATTAT pLKO.1 1651 CDS 100% 15.000 10.500 N POLR1B n/a
7 TRCN0000052919 GCTATGAACATCAAAGTGAAA pLKO.1 2854 CDS 100% 4.950 3.465 N POLR1B n/a
8 TRCN0000052920 GCCAATGTTTATCCAGCAGAA pLKO.1 316 CDS 100% 4.050 2.835 N POLR1B n/a
9 TRCN0000415811 GCTGAGGTGGGAGGATCATTT pLKO_005 3869 3UTR 100% 13.200 6.600 Y SULT1A1 n/a
10 TRCN0000166560 CCTCCGAAAGTGCTAGGATTA pLKO.1 3975 3UTR 100% 10.800 5.400 Y LINC00336 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 6144 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 6144 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 6144 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14305 pDONR223 100% 99.8% 99.6% None (many diffs) n/a
2 ccsbBroad304_14305 pLX_304 0% 99.8% 99.6% V5 (many diffs) n/a
3 TRCN0000480108 CCACAAAGTCTCGAGAAGAACCGG pLX_317 9.2% 99.8% 99.6% V5 (many diffs) n/a
Download CSV