Transcript: Human NM_001283035.1

Homo sapiens replication termination factor 2 (RTF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
RTF2 (51507)
Length:
1762
CDS:
114..1124

Additional Resources:

NCBI RefSeq record:
NM_001283035.1
NBCI Gene record:
RTF2 (51507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365074 GTCGACAAAGATGCTGAATTA pLKO_005 273 CDS 100% 13.200 18.480 N RTF2 n/a
2 TRCN0000142822 CAGCCTTGATTCTAGAGAGAA pLKO.1 896 CDS 100% 4.950 6.930 N RTF2 n/a
3 TRCN0000143283 GCCCAATGGAACTATTGTACT pLKO.1 297 CDS 100% 4.950 6.930 N RTF2 n/a
4 TRCN0000140756 GATGCTGAATTAGTGGCCCAA pLKO.1 282 CDS 100% 2.160 3.024 N RTF2 n/a
5 TRCN0000122229 GCAATAAATCAAGTAGGCCAA pLKO.1 1498 3UTR 100% 2.160 3.024 N RTF2 n/a
6 TRCN0000365073 GTGAACTTGGCAGACTTTATA pLKO_005 355 CDS 100% 15.000 10.500 N RTF2 n/a
7 TRCN0000370062 TGCAGAGTTGGCACATATTAA pLKO_005 1447 3UTR 100% 15.000 10.500 N RTF2 n/a
8 TRCN0000370061 AGGCCTACAAGTCCCTCTTTA pLKO_005 1030 CDS 100% 13.200 9.240 N RTF2 n/a
9 TRCN0000122542 CCAAGTGAAACTGGGCTTTAA pLKO.1 1515 3UTR 100% 13.200 9.240 N RTF2 n/a
10 TRCN0000370018 GAAGGCAGCATCTCACATTAA pLKO_005 431 CDS 100% 13.200 9.240 N RTF2 n/a
11 TRCN0000140232 GCCAAGTGAAACTGGGCTTTA pLKO.1 1514 3UTR 100% 10.800 7.560 N RTF2 n/a
12 TRCN0000139552 CCTGTGAACTTGGCAGACTTT pLKO.1 352 CDS 100% 4.950 3.465 N RTF2 n/a
13 TRCN0000140849 CAAGAGGCATGAACTGGTGAA pLKO.1 140 CDS 100% 4.050 2.835 N RTF2 n/a
14 TRCN0000217960 CAAGTGAAACTGGGCTTTAAA pLKO_005 1516 3UTR 100% 15.000 9.000 N RTF2 n/a
15 TRCN0000122230 GTACTCTAAGTCAGGAAATAT pLKO.1 313 CDS 100% 15.000 9.000 N RTF2 n/a
16 TRCN0000142823 CAGCAATGAATGAGAGCTCTT pLKO.1 943 CDS 100% 4.050 2.430 N RTF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08302 pDONR223 100% 90.9% 90.7% None 70_159del;601A>G n/a
2 ccsbBroad304_08302 pLX_304 0% 90.9% 90.7% V5 70_159del;601A>G n/a
3 TRCN0000472558 TTTCACGACAACCCCGTATTTTAA pLX_317 47.1% 90.9% 90.7% V5 70_159del;601A>G n/a
4 ccsbBroadEn_11993 pDONR223 100% 10.2% 8.2% None (many diffs) n/a
5 ccsbBroad304_11993 pLX_304 0% 10.2% 8.2% V5 (many diffs) n/a
6 TRCN0000491291 TGCCCGGATGGCTATCTTCTTGAG pLX_317 100% 10.2% 8.2% V5 (many diffs) n/a
Download CSV