Transcript: Human NM_001283049.2

Homo sapiens ubiquitin specific peptidase 8 (USP8), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
USP8 (9101)
Length:
18547
CDS:
176..3214

Additional Resources:

NCBI RefSeq record:
NM_001283049.2
NBCI Gene record:
USP8 (9101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007439 CCACAGATTGATCGTACTAAA pLKO.1 1157 CDS 100% 13.200 18.480 N USP8 n/a
2 TRCN0000284767 CCACAGATTGATCGTACTAAA pLKO_005 1157 CDS 100% 13.200 18.480 N USP8 n/a
3 TRCN0000007435 GCTGTGTTACTAGCACTATAT pLKO.1 3334 3UTR 100% 13.200 10.560 N USP8 n/a
4 TRCN0000284769 GCTGTGTTACTAGCACTATAT pLKO_005 3334 3UTR 100% 13.200 10.560 N USP8 n/a
5 TRCN0000272486 CACTGGAACCTTTCGTTATTA pLKO_005 1843 CDS 100% 15.000 10.500 N USP8 n/a
6 TRCN0000284765 CTCGAAGAATGCAGGATTATC pLKO_005 555 CDS 100% 13.200 9.240 N USP8 n/a
7 TRCN0000007437 GCCAGAATGAAGAGGTGTCTA pLKO.1 912 CDS 100% 4.950 3.465 N USP8 n/a
8 TRCN0000007438 GCCTTCATGTATTTGTCTCTA pLKO.1 2699 CDS 100% 4.950 3.465 N USP8 n/a
9 TRCN0000007436 CCCAGATATAACCCAGGCTAT pLKO.1 2014 CDS 100% 4.050 2.835 N USP8 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9822 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9822 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 8919 3UTR 100% 4.950 2.475 Y ORAI2 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7211 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 6716 3UTR 100% 4.950 2.475 Y LOC387873 n/a
15 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 7250 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 7250 3UTR 100% 4.050 2.025 Y ORAI2 n/a
17 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 7250 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 13053 3UTR 100% 4.050 2.025 Y LOC441087 n/a
19 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 6513 3UTR 100% 0.495 0.248 Y C11orf44 n/a
20 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7212 3UTR 100% 13.200 6.600 Y LIAS n/a
21 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6753 3UTR 100% 5.625 2.813 Y KLHL30 n/a
22 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 9820 3UTR 100% 4.950 2.475 Y ERN2 n/a
23 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 9820 3UTR 100% 4.950 2.475 Y P3H4 n/a
24 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 9820 3UTR 100% 4.950 2.475 Y P3H4 n/a
25 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6753 3UTR 100% 5.625 2.813 Y EID2B n/a
26 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 9012 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02081 pDONR223 100% 90.5% 90.5% None 102_103ins231;1572_1573ins87 n/a
2 ccsbBroad304_02081 pLX_304 0% 90.5% 90.5% V5 102_103ins231;1572_1573ins87 n/a
3 TRCN0000466074 AAAGAAGACGGCCCAATGCCACAC pLX_317 10.5% 90.5% 90.5% V5 102_103ins231;1572_1573ins87 n/a
Download CSV