Transcript: Human NM_001284333.2

Homo sapiens tousled like kinase 2 (TLK2), transcript variant C, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TLK2 (11011)
Length:
5405
CDS:
176..2494

Additional Resources:

NCBI RefSeq record:
NM_001284333.2
NBCI Gene record:
TLK2 (11011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147939 AGAGCTGGAGAGACTAGAAA pXPR_003 GGG 1291 56% 15 0.4661 TLK2 TLK2 75617
2 BRDN0001147069 GAGCCTCATTTACTGAACAG pXPR_003 TGG 930 40% 11 0.4147 TLK2 TLK2 75616
3 BRDN0001146448 GAACCATATGAAACTAGCCA pXPR_003 AGG 218 9% 4 0.004 TLK2 TLK2 75615
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322129 GCTGGTACTTATTGGTATTTA pLKO_005 2087 CDS 100% 15.000 21.000 N Tlk2 n/a
2 TRCN0000356159 GCTGGTACTTATTGGTATTTA pLKO_005 2087 CDS 100% 15.000 21.000 N TLK2 n/a
3 TRCN0000002361 GCAAGACATCCTACAAGAGAA pLKO.1 2236 CDS 100% 4.950 6.930 N TLK2 n/a
4 TRCN0000002363 CGGATTCATAAAGAGCTGGAT pLKO.1 1721 CDS 100% 2.640 3.696 N TLK2 n/a
5 TRCN0000356116 TGACCTCAAACCAGGTAATAT pLKO_005 1948 CDS 100% 15.000 10.500 N TLK2 n/a
6 TRCN0000195682 CACAAGGTGCTGGTACTTATT pLKO.1 2079 CDS 100% 13.200 9.240 N TLK2 n/a
7 TRCN0000356144 TAGGGAATACCGGATTCATAA pLKO_005 1711 CDS 100% 13.200 9.240 N TLK2 n/a
8 TRCN0000002362 TCTACATATCAGGGAACTAAA pLKO.1 1480 CDS 100% 13.200 9.240 N TLK2 n/a
9 TRCN0000002364 CAGTGAAGTTTACAAGGCATT pLKO.1 1594 CDS 100% 4.050 2.835 N TLK2 n/a
10 TRCN0000002365 TGGTGTTTGACTTCGGAGGAA pLKO.1 2979 3UTR 100% 2.640 1.848 N TLK2 n/a
11 TRCN0000356114 ACGATCCTCACCGCAACATTC pLKO_005 499 CDS 100% 10.800 5.400 Y TLK2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3792 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000195560 CCACTTAATAGTGAGTCTTCC pLKO.1 260 CDS 100% 4.050 2.025 Y TLK2 n/a
14 TRCN0000027013 GCAACCAATGAGCAGAAACAA pLKO.1 1241 CDS 100% 5.625 3.938 N Tlk2 n/a
15 TRCN0000322066 GCAACCAATGAGCAGAAACAA pLKO_005 1241 CDS 100% 5.625 3.938 N Tlk2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3793 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11580 pDONR223 100% 99.8% 99.8% None 1_3delATG n/a
2 ccsbBroad304_11580 pLX_304 0% 99.8% 99.8% V5 1_3delATG n/a
3 TRCN0000478401 TTACCGGTATGCAGATCCGGTTTT pLX_317 11.1% 99.8% 99.8% V5 1_3delATG n/a
4 ccsbBroadEn_14984 pDONR223 0% 99.8% 99.8% None 1_3delATG n/a
5 ccsbBroad304_14984 pLX_304 0% 99.8% 99.8% V5 1_3delATG n/a
6 TRCN0000474191 TTCGATGTTAGGTGTGTATCGATA pLX_317 18.7% 99.8% 99.8% V5 1_3delATG n/a
7 TRCN0000487715 TATTTCCAATGAACCAGATCAATC pLX_317 11.4% 97.1% 97.1% V5 (not translated due to prior stop codon) 1122_1187del n/a
8 TRCN0000489119 TACCTGTAGTGACCTCCCATAAGG pLX_317 13.2% 97.1% 97.1% V5 (not translated due to prior stop codon) 1122_1187del n/a
9 TRCN0000488113 TATTTTACTACGACAAAGTGCAGT pLX_317 11.3% 97.1% 97% V5 1122_1187del;2316_2317insG n/a
10 TRCN0000491778 AGGCAAGCATAGGGACCATCCCTT pLX_317 16.4% 97.1% 97% V5 1122_1187del;2316_2317insG n/a
Download CSV