Transcript: Human NM_001285448.1

Homo sapiens pyridoxal dependent decarboxylase domain containing 1 (PDXDC1), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
PDXDC1 (23042)
Length:
4498
CDS:
336..2429

Additional Resources:

NCBI RefSeq record:
NM_001285448.1
NBCI Gene record:
PDXDC1 (23042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001285448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338660 GAGTCCACAGAACCCATATAT pLKO_005 2073 CDS 100% 15.000 7.500 Y PDXDC1 n/a
2 TRCN0000160942 GCAGTGATTGTGGGATTGTAA pLKO.1 2917 3UTR 100% 5.625 2.813 Y PDXDC1 n/a
3 TRCN0000338727 GCAGTGATTGTGGGATTGTAA pLKO_005 2917 3UTR 100% 5.625 2.813 Y PDXDC1 n/a
4 TRCN0000158911 CCTATATGTTGATGACCCTAA pLKO.1 1589 CDS 100% 4.050 2.025 Y PDXDC1 n/a
5 TRCN0000164354 CGAGGTTCAGATGCTTTGAGT pLKO.1 2196 CDS 100% 3.000 1.500 Y PDXDC1 n/a
6 TRCN0000338657 CGAGGTTCAGATGCTTTGAGT pLKO_005 2196 CDS 100% 3.000 1.500 Y PDXDC1 n/a
7 TRCN0000163994 CCACGTTAGCTGAAATGGGAA pLKO.1 322 5UTR 100% 2.640 1.320 Y PDXDC1 n/a
8 TRCN0000163453 GAAGATGACCACTCACAGGTA pLKO.1 2385 CDS 100% 2.640 1.320 Y PDXDC1 n/a
9 TRCN0000338725 GAAGATGACCACTCACAGGTA pLKO_005 2385 CDS 100% 2.640 1.320 Y PDXDC1 n/a
10 TRCN0000135390 GCTTATTTCCACGAAGAGGAA pLKO.1 468 CDS 100% 2.640 1.320 Y PDXDC2P-NPIPB14P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11663 pDONR223 100% 54.9% 54.9% None 0_1ins45;113_114ins228;1300_2091del n/a
2 ccsbBroad304_11663 pLX_304 0% 54.9% 54.9% V5 0_1ins45;113_114ins228;1300_2091del n/a
3 TRCN0000475295 AGTCTTGCGTGTCTGTGAATAAAT pLX_317 24% 54.9% 54.9% V5 0_1ins45;113_114ins228;1300_2091del n/a
4 ccsbBroadEn_10342 pDONR223 100% 48.8% 45.3% None (many diffs) n/a
5 ccsbBroad304_10342 pLX_304 0% 48.8% 45.3% V5 (many diffs) n/a
6 TRCN0000479086 GTGACACGCCACTTGGAGCACCGT pLX_317 32% 48.8% 45.3% V5 (many diffs) n/a
Download CSV