Transcript: Mouse NM_001285505.1

Mus musculus ribosomal protein S6 kinase polypeptide 1 (Rps6ka1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rps6ka1 (20111)
Length:
3118
CDS:
166..2340

Additional Resources:

NCBI RefSeq record:
NM_001285505.1
NBCI Gene record:
Rps6ka1 (20111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145974 CTTGACAGCATACTCCATGT pXPR_003 TGG 1291 59% 15 1.0007 Rps6ka1 RPS6KA1 75497
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285729 CAGTGACGGCTACGTAGTAAA pLKO_005 1374 CDS 100% 13.200 18.480 N Rps6ka1 n/a
2 TRCN0000022826 GCACAGCTTGGGCATTATTTA pLKO.1 699 CDS 100% 15.000 12.000 N Rps6ka1 n/a
3 TRCN0000285730 GCACAGCTTGGGCATTATTTA pLKO_005 699 CDS 100% 15.000 12.000 N Rps6ka1 n/a
4 TRCN0000022827 CTACATACTCTGCTCTCAATA pLKO.1 2231 CDS 100% 13.200 10.560 N Rps6ka1 n/a
5 TRCN0000274674 CTACATACTCTGCTCTCAATA pLKO_005 2231 CDS 100% 13.200 10.560 N Rps6ka1 n/a
6 TRCN0000274655 GGCGTCATCTCCCATGAATTT pLKO_005 2555 3UTR 100% 13.200 9.240 N Rps6ka1 n/a
7 TRCN0000022828 CAGAGGAAATTAAGAGACATA pLKO.1 1067 CDS 100% 4.950 3.465 N Rps6ka1 n/a
8 TRCN0000022824 GCTCTATCTTATTCTGGACTT pLKO.1 573 CDS 100% 4.050 2.835 N Rps6ka1 n/a
9 TRCN0000274654 GCTCTATCTTATTCTGGACTT pLKO_005 573 CDS 100% 4.050 2.835 N Rps6ka1 n/a
10 TRCN0000022825 GATCAGCAAGACTGTGGAATA pLKO.1 1686 CDS 100% 10.800 6.480 N Rps6ka1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06896 pDONR223 100% 89.5% 97% None (many diffs) n/a
2 ccsbBroadEn_14830 pDONR223 0% 89.5% 97% None (many diffs) n/a
3 ccsbBroad304_14830 pLX_304 0% 89.5% 97% V5 (many diffs) n/a
4 TRCN0000470979 ACTGACTTTTCCCCTTGCATTGCC pLX_317 19.1% 89.5% 97% V5 (many diffs) n/a
5 TRCN0000492141 TTCACCAAATGGCCTGTTCCTGCA pLX_317 14% 89.5% 97% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000487686 GCTTCCTAGCCATACGCAGCGCCA pLX_317 10% 89.4% 96.8% V5 (many diffs) n/a
Download CSV