Transcript: Human NM_001286514.2

Homo sapiens activating transcription factor 7 interacting protein (ATF7IP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ATF7IP (55729)
Length:
8820
CDS:
154..3963

Additional Resources:

NCBI RefSeq record:
NM_001286514.2
NBCI Gene record:
ATF7IP (55729)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338503 GTCTAAACGTCGTCGATATAT pLKO_005 1848 CDS 100% 15.000 21.000 N ATF7IP n/a
2 TRCN0000338504 TACGAAGTAAGTAGATCAAAG pLKO_005 4307 3UTR 100% 10.800 15.120 N ATF7IP n/a
3 TRCN0000020828 CGTCGATATATGGAAGAAGAA pLKO.1 1858 CDS 100% 4.950 6.930 N ATF7IP n/a
4 TRCN0000020824 CCGCTGATGATATAGCCTCTA pLKO.1 827 CDS 100% 4.050 5.670 N ATF7IP n/a
5 TRCN0000338501 CCGCTGATGATATAGCCTCTA pLKO_005 827 CDS 100% 4.050 5.670 N ATF7IP n/a
6 TRCN0000020826 CCAAGGATATTTATGGACGTT pLKO.1 3884 CDS 100% 2.640 3.696 N ATF7IP n/a
7 TRCN0000020825 CCAGGGACTTTGGTGACTAAT pLKO.1 2554 CDS 100% 13.200 10.560 N ATF7IP n/a
8 TRCN0000338502 GATCTTGTAGAAACGATTAAT pLKO_005 1366 CDS 100% 15.000 10.500 N ATF7IP n/a
9 TRCN0000020827 CCCTGTATCCTAAGTGTTAAT pLKO.1 427 CDS 100% 13.200 9.240 N ATF7IP n/a
10 TRCN0000338435 CCCTGTATCCTAAGTGTTAAT pLKO_005 427 CDS 100% 13.200 9.240 N ATF7IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12261 pDONR223 100% 86.7% 86.1% None (many diffs) n/a
2 ccsbBroad304_12261 pLX_304 0% 86.7% 86.1% V5 (many diffs) n/a
3 TRCN0000477516 CGCTTCGGCAGCTTCAACGGCGCG pLX_317 15% 86.7% 86.1% V5 (many diffs) n/a
Download CSV