Transcript: Human NM_001289413.1

Homo sapiens euchromatic histone lysine methyltransferase 2 (EHMT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EHMT2 (10919)
Length:
4045
CDS:
5..3706

Additional Resources:

NCBI RefSeq record:
NM_001289413.1
NBCI Gene record:
EHMT2 (10919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437848 GGACCTTCATCTGCGAGTATG pLKO_005 3255 CDS 100% 10.800 15.120 N EHMT2 n/a
2 TRCN0000115670 CGAGAGAGTTCATGGCTCTTT pLKO.1 277 CDS 100% 4.950 6.930 N EHMT2 n/a
3 TRCN0000115667 CACACATTCCTGACCAGAGAT pLKO.1 3826 3UTR 100% 4.950 3.960 N EHMT2 n/a
4 TRCN0000115668 CCTCTTCGACTTAGACAACAA pLKO.1 3328 CDS 100% 4.950 3.960 N EHMT2 n/a
5 TRCN0000416235 AGATTGAGCCTCCGCTGATTT pLKO_005 3096 CDS 100% 13.200 9.240 N EHMT2 n/a
6 TRCN0000115671 CTCCAGGAATTTAACAAGATT pLKO.1 3080 CDS 100% 5.625 3.938 N EHMT2 n/a
7 TRCN0000115669 GCTCCAGGAATTTAACAAGAT pLKO.1 3079 CDS 100% 4.950 3.465 N EHMT2 n/a
8 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 1097 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
9 TRCN0000190517 GAGGAGGAAGAAGAAGAAGAA pLKO.1 1091 CDS 100% 4.950 2.475 Y G430095P16Rik n/a
10 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 1103 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11571 pDONR223 100% 76.2% 76.3% None 1_798del;882A>G;1284_1285ins102 n/a
2 ccsbBroad304_11571 pLX_304 0% 76.2% 76.3% V5 1_798del;882A>G;1284_1285ins102 n/a
3 TRCN0000479199 TCATGCGACGACAGCGGAGAATAG pLX_317 12.5% 76.2% 76.3% V5 1_798del;882A>G;1284_1285ins102 n/a
Download CSV