Transcript: Mouse NM_001289599.1

Mus musculus thioredoxin domain containing 5 (Txndc5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Txndc5 (105245)
Length:
2614
CDS:
239..1273

Additional Resources:

NCBI RefSeq record:
NM_001289599.1
NBCI Gene record:
Txndc5 (105245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099700 GCGGCACTGTTGACTTAGTAA pLKO.1 1644 3UTR 100% 5.625 4.500 N Txndc5 n/a
2 TRCN0000331628 GCGGCACTGTTGACTTAGTAA pLKO_005 1644 3UTR 100% 5.625 4.500 N Txndc5 n/a
3 TRCN0000099702 CCAGGCAAAGGATGAACTATA pLKO.1 1252 CDS 100% 13.200 9.240 N Txndc5 n/a
4 TRCN0000302659 CCAGGCAAAGGATGAACTATA pLKO_005 1252 CDS 100% 13.200 9.240 N Txndc5 n/a
5 TRCN0000099704 GACTCCTTACACAGCTTTGTT pLKO.1 1226 CDS 100% 5.625 3.938 N Txndc5 n/a
6 TRCN0000302660 GACTCCTTACACAGCTTTGTT pLKO_005 1226 CDS 100% 5.625 3.938 N Txndc5 n/a
7 TRCN0000099703 GAGACTTTGAAACACTGGAAA pLKO.1 441 CDS 100% 4.950 3.465 N Txndc5 n/a
8 TRCN0000302663 GAGACTTTGAAACACTGGAAA pLKO_005 441 CDS 100% 4.950 3.465 N Txndc5 n/a
9 TRCN0000099701 GCTGCATGTTTCTCAAGGCAA pLKO.1 577 CDS 100% 2.640 1.848 N Txndc5 n/a
10 TRCN0000331627 GCTGCATGTTTCTCAAGGCAA pLKO_005 577 CDS 100% 2.640 1.848 N Txndc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10525 pDONR223 100% 82.2% 84.7% None (many diffs) n/a
2 ccsbBroad304_10525 pLX_304 0% 82.2% 84.7% V5 (many diffs) n/a
3 TRCN0000475518 ATAGGTTCCCGGATTGCGTTTCCT pLX_317 30.2% 82.2% 84.7% V5 (many diffs) n/a
Download CSV