Transcript: Mouse NM_001290676.1

Mus musculus cytoplasmic polyadenylation element binding protein 4 (Cpeb4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cpeb4 (67579)
Length:
7631
CDS:
1349..3514

Additional Resources:

NCBI RefSeq record:
NM_001290676.1
NBCI Gene record:
Cpeb4 (67579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197762 GCTACTCATAACATTCAGGAT pLKO.1 1544 CDS 100% 2.640 3.696 N Cpeb4 n/a
2 TRCN0000198287 GTCCCTTACTGGTTTCAGTAA pLKO.1 1837 CDS 100% 0.495 0.693 N Cpeb4 n/a
3 TRCN0000435567 CCCTGGCGCTTCAGCTAATAA pLKO_005 1933 CDS 100% 15.000 12.000 N Cpeb4 n/a
4 TRCN0000420027 CGATAGTTCTCTGCTTATTAA pLKO_005 2584 CDS 100% 15.000 12.000 N Cpeb4 n/a
5 TRCN0000177316 GCAAAGCAATACTGGGAATAA pLKO.1 1378 CDS 100% 13.200 10.560 N Cpeb4 n/a
6 TRCN0000152631 GCATATTTCATTCCGCTGGAA pLKO.1 3490 CDS 100% 2.640 2.112 N CPEB4 n/a
7 TRCN0000150825 GCTGTTGGAAAGACTTGATAA pLKO.1 6724 3UTR 100% 13.200 9.240 N CPEB4 n/a
8 TRCN0000158083 CCAGTGTTGACAGGGTTTGAT pLKO.1 1760 CDS 100% 5.625 3.938 N CPEB4 n/a
9 TRCN0000198916 GAAGCTGGAATACTGCCTGAA pLKO.1 1655 CDS 100% 4.050 2.835 N Cpeb4 n/a
10 TRCN0000156565 GCTGCCTCATTTGGCGAATAA pLKO.1 2158 CDS 100% 13.200 7.920 N CPEB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12692 pDONR223 100% 41.9% 44.3% None (many diffs) n/a
2 ccsbBroad304_12692 pLX_304 0% 41.9% 44.3% V5 (many diffs) n/a
3 TRCN0000491501 CTTGCGGGTGCGAGCAGGAATTAG pLX_317 35.5% 41.9% 44.3% V5 (many diffs) n/a
Download CSV