Transcript: Mouse NM_001291192.1

Mus musculus myocyte enhancer factor 2A (Mef2a), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mef2a (17258)
Length:
5554
CDS:
357..1835

Additional Resources:

NCBI RefSeq record:
NM_001291192.1
NBCI Gene record:
Mef2a (17258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095962 GATTGGAAATACTGGTGCAAA pLKO.1 1070 CDS 100% 4.950 6.930 N Mef2a n/a
2 TRCN0000333907 GATTGGAAATACTGGTGCAAA pLKO_005 1070 CDS 100% 4.950 6.930 N Mef2a n/a
3 TRCN0000005133 CCAGACCCTGATACTTCATAT pLKO.1 651 CDS 100% 13.200 10.560 N MEF2A n/a
4 TRCN0000422926 GTGAAATAGCACTCATCATTT pLKO_005 478 CDS 100% 13.200 9.240 N MEF2A n/a
5 TRCN0000005132 GCCTAGAAATATAGAGCATTA pLKO.1 2537 3UTR 100% 10.800 7.560 N MEF2A n/a
6 TRCN0000095961 GCAGTTATCTCAGGGTTCAAA pLKO.1 1484 CDS 100% 5.625 3.938 N Mef2a n/a
7 TRCN0000333987 GCAGTTATCTCAGGGTTCAAA pLKO_005 1484 CDS 100% 5.625 3.938 N Mef2a n/a
8 TRCN0000095963 CCAAATACTGAGGACAGAGAA pLKO.1 1770 CDS 100% 4.950 3.465 N Mef2a n/a
9 TRCN0000095960 CCAGCTCAACATTAGCAGATT pLKO.1 865 CDS 100% 4.950 3.465 N Mef2a n/a
10 TRCN0000333985 CCAGCTCAACATTAGCAGATT pLKO_005 865 CDS 100% 4.950 3.465 N Mef2a n/a
11 TRCN0000095959 CCCTTAATGAATTGATGACTA pLKO.1 2680 3UTR 100% 4.950 3.465 N Mef2a n/a
12 TRCN0000333988 CCCTTAATGAATTGATGACTA pLKO_005 2680 3UTR 100% 4.950 3.465 N Mef2a n/a
13 TRCN0000431440 TTGGACTACTTGTTTCGTAAA pLKO_005 2118 3UTR 100% 10.800 7.560 N MEF2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06575 pDONR223 100% 90% 95.5% None (many diffs) n/a
2 ccsbBroad304_06575 pLX_304 0% 90% 95.5% V5 (many diffs) n/a
3 TRCN0000472816 CTCACACGAGAGGTCGTGTTGCCG pLX_317 9.8% 90% 95.5% V5 (many diffs) n/a
4 ccsbBroadEn_10962 pDONR223 100% 73.2% 72.3% None (many diffs) n/a
5 ccsbBroad304_10962 pLX_304 0% 73.2% 72.3% V5 (many diffs) n/a
6 TRCN0000479180 TCCACGCGCTGTGCATCGGTCAAG pLX_317 29.8% 73.2% 72.3% V5 (many diffs) n/a
Download CSV