Transcript: Human NM_001291963.2

Homo sapiens death associated protein (DAP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
DAP (1611)
Length:
2258
CDS:
167..781

Additional Resources:

NCBI RefSeq record:
NM_001291963.2
NBCI Gene record:
DAP (1611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107216 CGCCGTGAAAGCTGGTGGAAT pLKO.1 217 CDS 100% 1.650 2.310 N DAP n/a
2 TRCN0000369536 AGGATGACCAGGAATGGGAAA pLKO_005 291 CDS 100% 4.050 2.835 N DAP n/a
3 TRCN0000369475 ATGCCTCCATGGACAAGCATC pLKO_005 371 CDS 100% 4.050 2.835 N DAP n/a
4 TRCN0000107215 CCAGATAAGAAACCTGCCCTT pLKO.1 1296 3UTR 100% 2.160 1.512 N DAP n/a
5 TRCN0000333268 CCAGATAAGAAACCTGCCCTT pLKO_005 1296 3UTR 100% 2.160 1.512 N DAP n/a
6 TRCN0000107217 CGAATTGTGCAGAAACACCCA pLKO.1 239 CDS 100% 0.660 0.462 N DAP n/a
7 TRCN0000333187 CGAATTGTGCAGAAACACCCA pLKO_005 239 CDS 100% 0.660 0.462 N DAP n/a
8 TRCN0000107219 GCACATCCAGCAGCCACGCAA pLKO.1 408 CDS 100% 0.000 0.000 N DAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00420 pDONR223 100% 40.1% 27.5% None 151_152ins43;264_612del n/a
2 ccsbBroad304_00420 pLX_304 0% 40.1% 27.5% V5 151_152ins43;264_612del n/a
3 TRCN0000472873 ACCCTGAAACCACCGTTTTAAACC pLX_317 100% 40.1% 27.5% V5 151_152ins43;264_612del n/a
4 TRCN0000489534 AGCCACTTTTCAATCACTGCGGCG pLX_317 71.3% 40.1% 26.4% V5 151_152ins43;264_612delinsG n/a
5 TRCN0000488842 GCATTGGCATGCGCTGTCGGGTTC pLX_317 92.2% 40.1% 27.5% V5 (not translated due to prior stop codon) 151_152ins43;264_612del n/a
Download CSV