Transcript: Human NM_001294339.2

Homo sapiens CDC like kinase 2 (CLK2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CLK2 (1196)
Length:
2066
CDS:
901..1716

Additional Resources:

NCBI RefSeq record:
NM_001294339.2
NBCI Gene record:
CLK2 (1196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001294339.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229970 GCTACAGACGCAACGATTATA pLKO_005 531 5UTR 100% 15.000 21.000 N CLK2 n/a
2 TRCN0000195230 CTATCGGCATTCCTATGAATA pLKO.1 586 5UTR 100% 13.200 18.480 N CLK2 n/a
3 TRCN0000229971 CTATCGGCATTCCTATGAATA pLKO_005 586 5UTR 100% 13.200 18.480 N CLK2 n/a
4 TRCN0000355628 GTCCGTTCTCGAAGCAGTTAT pLKO_005 461 5UTR 100% 13.200 18.480 N CLK2 n/a
5 TRCN0000378116 GATATCAGTCGGTGACGATCA pLKO_005 1702 CDS 100% 4.050 5.670 N CLK2 n/a
6 TRCN0000195366 CCTGACAACAAGAACCTCTGT pLKO.1 874 5UTR 100% 2.640 2.112 N CLK2 n/a
7 TRCN0000229973 TTCCTCCTGGCTCTCTATATA pLKO_005 1817 3UTR 100% 15.000 10.500 N CLK2 n/a
8 TRCN0000000750 CTTCCTCCTGGCTCTCTATAT pLKO.1 1816 3UTR 100% 13.200 9.240 N CLK2 n/a
9 TRCN0000378190 CTATCGGAGCCGAAAGCATAA pLKO_005 367 5UTR 100% 10.800 7.560 N CLK2 n/a
10 TRCN0000196747 GCCTTGTACATAATACTATTC pLKO.1 1898 3UTR 100% 10.800 7.560 N CLK2 n/a
11 TRCN0000000752 GAAAGCATAAGCGACGAAGAA pLKO.1 378 5UTR 100% 4.950 3.465 N CLK2 n/a
12 TRCN0000000751 GAGATCAACGTGCTAGAGAAA pLKO.1 838 5UTR 100% 4.950 3.465 N CLK2 n/a
13 TRCN0000000753 GAAGCAGTTATGATGATCGTT pLKO.1 471 5UTR 100% 3.000 2.100 N CLK2 n/a
14 TRCN0000355629 GACTTGAGATCAACGTGCTAG pLKO_005 833 5UTR 100% 4.050 2.430 N CLK2 n/a
15 TRCN0000199189 CGAGCCAGAGTTCACTCCTTC pLKO.1 1799 3UTR 100% 1.350 0.810 N CLK2 n/a
16 TRCN0000218146 AGTTGCCCTGAAGATCATTAA pLKO_005 783 5UTR 100% 13.200 6.600 Y CLK2 n/a
17 TRCN0000321839 AGTTGCCCTGAAGATCATTAA pLKO_005 783 5UTR 100% 13.200 6.600 Y Clk2 n/a
18 TRCN0000021592 CCTTGTGATGTGTGGAGTATA pLKO.1 1297 CDS 100% 13.200 6.600 Y CLK2P1 n/a
19 TRCN0000321841 CATTGTCTCCACTCGCCATTA pLKO_005 1236 CDS 100% 10.800 5.400 Y Clk2 n/a
20 TRCN0000197205 GCTCTTCGATCTGATTGAAAG pLKO.1 1569 CDS 100% 10.800 5.400 Y CLK2 n/a
21 TRCN0000229972 GGGCCTTAGCACCTTCGATTT pLKO_005 954 CDS 100% 10.800 5.400 Y CLK2 n/a
22 TRCN0000321882 GGGCCTTAGCACCTTCGATTT pLKO_005 954 CDS 100% 10.800 5.400 Y Clk2 n/a
23 TRCN0000023058 CAGCTCTTCGATCTGATTGAA pLKO.1 1567 CDS 100% 5.625 2.813 Y Clk2 n/a
24 TRCN0000021590 GCCCTGAAGATCATTAAGAAT pLKO.1 787 5UTR 100% 5.625 2.813 Y CLK2P1 n/a
25 TRCN0000021591 GCTGTCAAGTTCCTCCATGAT pLKO.1 1045 CDS 100% 4.950 2.475 Y CLK2P1 n/a
26 TRCN0000010543 GTGGAGTATAGGCTGCATCAT pLKO.1 1308 CDS 100% 4.950 2.475 Y CLK2 n/a
27 TRCN0000021593 GCTGACACATACAGACCTCAA pLKO.1 1071 CDS 100% 4.050 2.025 Y CLK2P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001294339.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00327 pDONR223 100% 54.4% 54.4% None 0_1ins681 n/a
2 ccsbBroad304_00327 pLX_304 0% 54.4% 54.4% V5 0_1ins681 n/a
3 TRCN0000480750 CTGCAGTTAGTACGTGCACGGGAA pLX_317 25.9% 54.4% 54.4% V5 0_1ins681 n/a
4 TRCN0000487839 TTGGACACTTTAGTTCTCCCGCAA pLX_317 20.2% 54.4% 54.4% V5 (not translated due to prior stop codon) 0_1ins681 n/a
5 ccsbBroadEn_10738 pDONR223 100% 54.3% 54.3% None 0_1ins684 n/a
6 ccsbBroad304_10738 pLX_304 0% 54.3% 54.3% V5 0_1ins684 n/a
7 TRCN0000466552 GCGTTAACGGCCATAGATCGCATC pLX_317 24.3% 54.3% 54.3% V5 0_1ins684 n/a
8 ccsbBroadEn_14590 pDONR223 0% 54.3% 54.3% None 0_1ins684 n/a
9 ccsbBroad304_14590 pLX_304 0% 54.3% 54.3% V5 0_1ins684 n/a
10 TRCN0000481442 TCCAGCGAGGTGGGTGCTCGCTAC pLX_317 33.5% 54.3% 54.3% V5 0_1ins684 n/a
11 TRCN0000489118 CTCACACACCATTGACACCAGAAT pLX_317 24.7% 53.5% 10.2% V5 (not translated due to prior stop codon) 0_1ins704 n/a
12 TRCN0000491251 CTGGCTTCTTTATATCCTCAAACG pLX_317 11.6% 53.5% 10.2% V5 (not translated due to prior stop codon) 0_1ins704;813_814insG n/a
Download CSV