Transcript: Human NM_001302616.2

Homo sapiens acylphosphatase 1 (ACYP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
ACYP1 (97)
Length:
562
CDS:
62..361

Additional Resources:

NCBI RefSeq record:
NM_001302616.2
NBCI Gene record:
ACYP1 (97)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353091 CATCTCCAAGGTGCGTCATAT pLKO_005 226 CDS 100% 13.200 9.240 N ACYP1 n/a
2 TRCN0000344801 GGGCACAGTGCAAGGACAATT pLKO_005 196 CDS 100% 13.200 9.240 N ACYP1 n/a
3 TRCN0000050447 AGTCATCTTGAAGTTGGATTA pLKO.1 316 CDS 100% 10.800 7.560 N ACYP1 n/a
4 TRCN0000333277 AGTCATCTTGAAGTTGGATTA pLKO_005 316 CDS 100% 10.800 7.560 N ACYP1 n/a
5 TRCN0000344802 CTAAATCACACATCGACAAAG pLKO_005 276 CDS 100% 10.800 7.560 N ACYP1 n/a
6 TRCN0000344800 ATAAACTCAGTGGTTTGGTTT pLKO_005 386 3UTR 100% 4.950 3.465 N ACYP1 n/a
7 TRCN0000050443 CCTAAATCACACATCGACAAA pLKO.1 275 CDS 100% 4.950 3.465 N ACYP1 n/a
8 TRCN0000050444 CGACAAAGCAAACTTCAACAA pLKO.1 289 CDS 100% 4.950 3.465 N ACYP1 n/a
9 TRCN0000378581 GAGATAGAACTATTGTGTGTT pLKO_005 419 3UTR 100% 4.950 3.465 N ACYP1 n/a
10 TRCN0000378662 GAATGGCTTGAAACAAGAGGA pLKO_005 251 CDS 100% 2.640 1.848 N ACYP1 n/a
11 TRCN0000050446 CCCATCTCCAAGGTGCGTCAT pLKO.1 224 CDS 100% 1.350 0.945 N ACYP1 n/a
12 TRCN0000050445 GATTACTCAGACTTCCAAATT pLKO.1 332 CDS 100% 13.200 7.920 N ACYP1 n/a
13 TRCN0000363131 CATACTCAGGCTGAGGGTAAA pLKO_005 137 CDS 100% 10.800 6.480 N ACYP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00021 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00021 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468816 AGCCAGTCACCCTGAGGCTAACGC pLX_317 100% 100% 100% V5 n/a
4 TRCN0000488485 GTTCCTGCCATCGTCTCGCAAGAG pLX_317 100% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000491344 AATCGTATTCCGTGCACCCGACTG pLX_317 100% 99.6% 99% V5 297_298insG n/a
Download CSV