Transcript: Human NM_001304963.2

Homo sapiens nudix hydrolase 10 (NUDT10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
NUDT10 (170685)
Length:
1925
CDS:
145..639

Additional Resources:

NCBI RefSeq record:
NM_001304963.2
NBCI Gene record:
NUDT10 (170685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360294 CTAATCTGTCTAGCATATATG pLKO_005 1049 3UTR 100% 13.200 18.480 N NUDT10 n/a
2 TRCN0000078588 GCCCAAACATTGAACCTAAAT pLKO.1 1334 3UTR 100% 13.200 18.480 N NUDT10 n/a
3 TRCN0000360296 CCGCTGTATCTGTACATAATT pLKO_005 819 3UTR 100% 15.000 10.500 N NUDT10 n/a
4 TRCN0000360295 CTAGTGAATGGCATAGATGTT pLKO_005 636 CDS 100% 0.000 0.000 N NUDT10 n/a
5 TRCN0000360297 GATAGCGATCCCTAGTGAATG pLKO_005 625 CDS 100% 10.800 6.480 N NUDT10 n/a
6 TRCN0000050303 GCCGAATATCTGGAGAAACTA pLKO.1 553 CDS 100% 5.625 2.813 Y NUDT11 n/a
7 TRCN0000050306 TGCTGGAGGATTGGGAAGATT pLKO.1 452 CDS 100% 5.625 2.813 Y NUDT11 n/a
8 TRCN0000327651 TGCTGGAGGATTGGGAAGATT pLKO_005 452 CDS 100% 5.625 2.813 Y NUDT11 n/a
9 TRCN0000078589 CGCCGAATATCTGGAGAAACT pLKO.1 552 CDS 100% 4.950 2.475 Y NUDT10 n/a
10 TRCN0000078592 TGGGAAGATTCGGTTAGCATT pLKO.1 463 CDS 100% 4.950 2.475 Y NUDT10 n/a
11 TRCN0000050307 CAAGCACAGAACGTACGTGTA pLKO.1 411 CDS 100% 4.050 2.025 Y NUDT11 n/a
12 TRCN0000050305 CCCAACCAATGGAAACTCCAT pLKO.1 588 CDS 100% 2.640 1.320 Y NUDT11 n/a
13 TRCN0000050304 CGAGAGTGGTTCAAAGTCGAA pLKO.1 493 CDS 100% 2.640 1.320 Y NUDT11 n/a
14 TRCN0000078591 AGAAACTAAAGCTGGGCGGTT pLKO.1 566 CDS 100% 2.160 1.080 Y NUDT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16119 pDONR223 0% 99.7% 99.3% None 268A>G n/a
2 ccsbBroad304_16119 pLX_304 0% 99.7% 99.3% V5 268A>G n/a
3 TRCN0000468380 TTCAACATATTGCCGCGCTGGCAA pLX_317 79.2% 99.7% 99.3% V5 268A>G n/a
4 ccsbBroadEn_09782 pDONR223 100% 99.3% 99.3% None 201C>T;310C>T;403G>A n/a
5 ccsbBroad304_09782 pLX_304 0% 99.3% 99.3% V5 201C>T;310C>T;403G>A n/a
6 TRCN0000471165 TCGTGAAGCGCCATCCACTGCGAA pLX_317 92.3% 99.3% 99.3% V5 201C>T;310C>T;403G>A n/a
7 ccsbBroadEn_08486 pDONR223 100% 98.5% 98.1% None (many diffs) n/a
8 ccsbBroad304_08486 pLX_304 0% 98.5% 98.1% V5 (many diffs) n/a
9 TRCN0000471707 AATGTGCACGACCTAGGGATGGTG pLX_317 55% 98.5% 98.1% V5 (many diffs) n/a
10 TRCN0000465307 CCGACAAATGACTTCGTTAGGTGT pLX_317 60.3% 72.9% 81.2% V5 (many diffs) n/a
11 ccsbBroadEn_14064 pDONR223 100% 72.9% 47.3% None (many diffs) n/a
12 ccsbBroad304_14064 pLX_304 0% 72.9% 47.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV