Transcript: Human NM_001305019.1

Homo sapiens zinc finger protein 747 (ZNF747), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-06
Taxon:
Homo sapiens (human)
Gene:
ZNF747 (65988)
Length:
3433
CDS:
292..1284

Additional Resources:

NCBI RefSeq record:
NM_001305019.1
NBCI Gene record:
ZNF747 (65988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019164 GTGGCGAAGTGTCCGACAGAA pLKO.1 604 CDS 100% 1.650 2.310 N ZNF747 n/a
2 TRCN0000019167 TGTCCGACAGAAGCGGACCCA pLKO.1 613 CDS 100% 0.000 0.000 N ZNF747 n/a
3 TRCN0000019166 CCAGAAACAAGGAAGAGGAAA pLKO.1 638 CDS 100% 4.950 2.970 N ZNF747 n/a
4 TRCN0000019168 GAAGAGGAAAGACAAAGGGAA pLKO.1 649 CDS 100% 2.640 1.584 N ZNF747 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1876 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1876 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09344 pDONR223 100% 69.1% 65.8% None (many diffs) n/a
2 ccsbBroad304_09344 pLX_304 0% 69.1% 65.8% V5 (many diffs) n/a
3 TRCN0000467045 ATTCCTTGAAGTCGGTAGCTTGTG pLX_317 26.6% 69.1% 65.8% V5 (many diffs) n/a
4 ccsbBroadEn_04001 pDONR223 100% 37.9% 31.2% None 228_229ins140;340_341insCAG;431_990del n/a
5 ccsbBroad304_04001 pLX_304 0% 37.9% 31.2% V5 228_229ins140;340_341insCAG;431_990del n/a
6 TRCN0000491881 ATGTTTATACCCAGTGGGACCTTG pLX_317 57.5% 37.9% 31.2% V5 228_229ins140;340_341insCAG;431_990del n/a
Download CSV