Transcript: Human NM_001308476.3

Homo sapiens cysteinyl leukotriene receptor 2 (CYSLTR2), transcript variant V, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CYSLTR2 (57105)
Length:
4763
CDS:
355..1395

Additional Resources:

NCBI RefSeq record:
NM_001308476.3
NBCI Gene record:
CYSLTR2 (57105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221093 GCTTCAATCCTCTGCTCTATT pLKO.1 1250 CDS 100% 13.200 10.560 N CYSLTR2 n/a
2 TRCN0000221096 CCTTATCATGGCTTCCTCAAT pLKO.1 846 CDS 100% 4.950 3.960 N CYSLTR2 n/a
3 TRCN0000356873 CCCTTCAGGGCTGACTATTAT pLKO_005 628 CDS 100% 15.000 10.500 N CYSLTR2 n/a
4 TRCN0000367685 GGAAATGGGTTGTCCATATAT pLKO_005 517 CDS 100% 15.000 10.500 N CYSLTR2 n/a
5 TRCN0000221095 CCTGCAGGATTATGTCTTATT pLKO.1 683 CDS 100% 13.200 9.240 N CYSLTR2 n/a
6 TRCN0000356934 TTCAATCCTCTGCTCTATTAC pLKO_005 1252 CDS 100% 13.200 9.240 N CYSLTR2 n/a
7 TRCN0000221092 CCCAACAAATGTTGATTCTTA pLKO.1 1483 3UTR 100% 5.625 3.938 N CYSLTR2 n/a
8 TRCN0000221094 CGTATCAGAAATGGAACCAAA pLKO.1 393 CDS 100% 4.950 3.465 N CYSLTR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489392 ACAAACATAGGACCCCGTAGGATA pLX_317 43.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_08698 pDONR223 100% 99.9% 99.7% None 475T>A n/a
3 ccsbBroad304_08698 pLX_304 0% 99.9% 99.7% V5 475T>A n/a
4 TRCN0000478078 AAGAACCGGTCCGCGATAATCGGT pLX_317 40.7% 99.9% 99.7% V5 475T>A n/a
5 TRCN0000488820 CCCATTTGTGTACACCACAATGAG pLX_317 31.5% 99.8% 100% V5 1037_1038delTA n/a
6 TRCN0000489573 CACCCCACTTGGCTGGGTCACCAT pLX_317 42.6% 95.3% 95.3% V5 (not translated due to prior stop codon) 1_48del n/a
7 TRCN0000488131 AGTGAAGCATTGTACCTTACTTAT pLX_317 30.1% 95.1% 95.3% V5 1_48del;1037_1038delTA n/a
Download CSV