Transcript: Mouse NM_001310448.1

Mus musculus cyclin-dependent kinase 14 (Cdk14), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Cdk14 (18647)
Length:
5168
CDS:
505..1776

Additional Resources:

NCBI RefSeq record:
NM_001310448.1
NBCI Gene record:
Cdk14 (18647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321940 TTACATCCACCAGCGTTATAT pLKO_005 1101 CDS 100% 15.000 21.000 N Cdk14 n/a
2 TRCN0000322009 CAAGAACTACGTGACGATTAA pLKO_005 2021 3UTR 100% 13.200 10.560 N Cdk14 n/a
3 TRCN0000023240 GCACACTGATTTATGTCAGTA pLKO.1 1005 CDS 100% 0.495 0.396 N Cdk14 n/a
4 TRCN0000322008 GATCAACTTGAACGGATATTT pLKO_005 1384 CDS 100% 15.000 10.500 N Cdk14 n/a
5 TRCN0000023241 GCCTTAGACAAGCATGGAATA pLKO.1 1499 CDS 100% 10.800 7.560 N Cdk14 n/a
6 TRCN0000321937 GCCTTAGACAAGCATGGAATA pLKO_005 1499 CDS 100% 10.800 7.560 N Cdk14 n/a
7 TRCN0000023239 GCTGACTGATATGTCTTCTAT pLKO.1 1650 CDS 100% 5.625 3.938 N Cdk14 n/a
8 TRCN0000322007 GCTGACTGATATGTCTTCTAT pLKO_005 1650 CDS 100% 5.625 3.938 N Cdk14 n/a
9 TRCN0000023243 CCATCCAGATAATGTGAAGTT pLKO.1 1050 CDS 100% 4.950 3.465 N Cdk14 n/a
10 TRCN0000023031 GCTTCCCTGTTGAAAGGACTA pLKO.1 910 CDS 100% 4.050 2.835 N LOC384291 n/a
11 TRCN0000002366 GAGTTCATTCTTTACCACATT pLKO.1 1442 CDS 100% 4.950 2.970 N CDK14 n/a
12 TRCN0000002367 GCAAAGAGTCACCTAAAGTTA pLKO.1 692 CDS 100% 5.625 3.938 N CDK14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491739 ATTAAAAGAGAAATATGCATACGC pLX_317 27.6% 85.6% 92.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14748 pDONR223 100% 85.1% 91.5% None (many diffs) n/a
3 ccsbBroad304_14748 pLX_304 0% 85.1% 91.5% V5 (many diffs) n/a
Download CSV