Transcript: Human NM_001317134.2

Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PFKFB4 (5210)
Length:
3647
CDS:
88..1584

Additional Resources:

NCBI RefSeq record:
NM_001317134.2
NBCI Gene record:
PFKFB4 (5210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423212 CTCCTACGAGTCGCTAGATGA pLKO_005 774 CDS 100% 4.950 6.930 N PFKFB4 n/a
2 TRCN0000428775 GAGGCGCATTGAGTGCTATGA pLKO_005 750 CDS 100% 4.950 6.930 N PFKFB4 n/a
3 TRCN0000037764 GCCAACATCGTGCAAGTGAAA pLKO.1 673 CDS 100% 4.950 6.930 N PFKFB4 n/a
4 TRCN0000037767 CCGCATCGTATATTACCTCAT pLKO.1 882 CDS 100% 4.050 5.670 N PFKFB4 n/a
5 TRCN0000199820 GCGCAGCTCTTAGGTGTTCAC pLKO.1 1863 3UTR 100% 1.350 1.890 N PFKFB4 n/a
6 TRCN0000199335 CCGACAATGAAGAGGGCCTGA pLKO.1 455 CDS 100% 0.720 1.008 N PFKFB4 n/a
7 TRCN0000434350 CCAACTGCCCAACTCTCATTG pLKO_005 281 CDS 100% 10.800 7.560 N PFKFB4 n/a
8 TRCN0000199909 GCTGATTGGCTGCCACATTTC pLKO.1 3498 3UTR 100% 10.800 7.560 N PFKFB4 n/a
9 TRCN0000195584 CAAGAGTCTAGCCCAGTTCAT pLKO.1 1020 CDS 100% 4.950 3.465 N PFKFB4 n/a
10 TRCN0000037765 CCTACGAGGAAATTCAGGATA pLKO.1 1181 CDS 100% 4.950 3.465 N PFKFB4 n/a
11 TRCN0000196609 GAGAACAGAATGGCTACAAGA pLKO.1 608 CDS 100% 4.950 3.465 N PFKFB4 n/a
12 TRCN0000199385 CCTCAGAACGTGGACATCTCA pLKO.1 1519 CDS 100% 3.000 2.100 N PFKFB4 n/a
13 TRCN0000199612 GCACTGGGTGTGCCCTATGAA pLKO.1 1111 CDS 100% 1.875 1.313 N PFKFB4 n/a
14 TRCN0000199852 GCTGGCCTACTTCCTCGACAA pLKO.1 1368 CDS 100% 1.350 0.945 N PFKFB4 n/a
15 TRCN0000197279 GATAGGGACCTGTCCTATATC pLKO.1 802 CDS 100% 1.320 0.924 N PFKFB4 n/a
16 TRCN0000037766 CCTGTGGCATATGGTTGTAAA pLKO.1 1447 CDS 100% 0.000 0.000 N PFKFB4 n/a
17 TRCN0000037768 GACGTGGTCAAGACCTACAAA pLKO.1 415 CDS 100% 5.625 3.375 N PFKFB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.