Transcript: Human NM_001317775.1

Homo sapiens rhophilin associated tail protein 1 (ROPN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-01-12
Taxon:
Homo sapiens (human)
Gene:
ROPN1 (54763)
Length:
922
CDS:
410..772

Additional Resources:

NCBI RefSeq record:
NM_001317775.1
NBCI Gene record:
ROPN1 (54763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048597 CCCTGATGGTATAATCACAGT pLKO.1 712 CDS 100% 2.640 3.696 N ROPN1 n/a
2 TRCN0000425751 TACATGGAACAGGAAGTAATT pLKO_005 689 CDS 100% 13.200 7.920 N ROPN1 n/a
3 TRCN0000419758 TCTTATCATGTGACCATAATG pLKO_005 564 CDS 100% 13.200 7.920 N ROPN1 n/a
4 TRCN0000048593 GATGGTATAATCACAGTGAAT pLKO.1 716 CDS 100% 4.950 2.970 N ROPN1 n/a
5 TRCN0000048595 ACAGTGAATGACTTTACCCAA pLKO.1 728 CDS 100% 2.640 1.584 N ROPN1 n/a
6 TRCN0000427208 AGCGCTCTGGGAGTTACTATT pLKO_005 515 CDS 100% 13.200 6.600 Y ROPN1 n/a
7 TRCN0000417004 ATCTCCCAACAGATCTGTTTA pLKO_005 426 CDS 100% 13.200 6.600 Y ROPN1 n/a
8 TRCN0000048596 CCAGTTTCTCTACACGTATAT pLKO.1 616 CDS 100% 13.200 6.600 Y ROPN1 n/a
9 TRCN0000140466 GAGATCGAGTGGCTGAAGTTT pLKO.1 479 CDS 100% 5.625 2.813 Y ROPN1B n/a
10 TRCN0000141183 CAGATGTGGAAAGTGGTGAAT pLKO.1 407 5UTR 100% 4.950 2.475 Y ROPN1B n/a
11 TRCN0000142665 CAGCAGGATGCTAAACTACAT pLKO.1 673 CDS 100% 4.950 2.475 Y ROPN1B n/a
12 TRCN0000141860 GAATCTCCCAACAGATCTGTT pLKO.1 424 CDS 100% 4.950 2.475 Y ROPN1B n/a
13 TRCN0000139110 CCAGATGTGGAAAGTGGTGAA pLKO.1 406 5UTR 100% 4.050 2.025 Y ROPN1B n/a
14 TRCN0000142211 GAGCTGTTAAAGATCCTGCAT pLKO.1 341 5UTR 100% 2.640 1.320 Y ROPN1B n/a
15 TRCN0000142494 GCTAACACCTGAGCTGTTAAA pLKO.1 331 5UTR 100% 1.320 0.660 Y ROPN1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13284 pDONR223 100% 96.6% 95% None (many diffs) n/a
2 ccsbBroad304_13284 pLX_304 0% 96.6% 95% V5 (many diffs) n/a
3 TRCN0000478753 CCTGCACTCTGCGGAGAACTGCCG pLX_317 100% 96.6% 95% V5 (many diffs) n/a
4 ccsbBroadEn_03456 pDONR223 100% 56.6% 56.6% None 0_1ins276 n/a
5 ccsbBroad304_03456 pLX_304 0% 56.6% 56.6% V5 0_1ins276 n/a
6 TRCN0000469769 TCGGCTGCCCCAACCTTCTTTAAG pLX_317 64.7% 56.6% 56.6% V5 0_1ins276 n/a
Download CSV