Transcript: Human NM_001317975.2

Homo sapiens NOP16 nucleolar protein (NOP16), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
NOP16 (51491)
Length:
970
CDS:
164..685

Additional Resources:

NCBI RefSeq record:
NM_001317975.2
NBCI Gene record:
NOP16 (51491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293211 ATGCCTGGGACCACGCTAAAT pLKO_005 270 CDS 100% 13.200 18.480 N NOP16 n/a
2 TRCN0000293162 ACATAGAGGAGAGGCCTAAAG pLKO_005 384 CDS 100% 10.800 15.120 N NOP16 n/a
3 TRCN0000298450 CTTGTACGGAAGCCCTATGTG pLKO_005 407 CDS 100% 4.950 6.930 N NOP16 n/a
4 TRCN0000072546 TCGGAGTAAGATCAACGTCTA pLKO.1 592 CDS 100% 4.050 5.670 N NOP16 n/a
5 TRCN0000072547 GAAGTTTGGTTACAGTGTCAA pLKO.1 92 5UTR 100% 4.950 3.960 N NOP16 n/a
6 TRCN0000307890 GAAGTTTGGTTACAGTGTCAA pLKO_005 92 5UTR 100% 4.950 3.960 N NOP16 n/a
7 TRCN0000072543 TCCCATGGAATCAGAAGGTTA pLKO.1 795 3UTR 100% 4.950 3.960 N NOP16 n/a
8 TRCN0000072545 CGGGACCTCATTGACTATGTA pLKO.1 485 CDS 100% 5.625 3.938 N NOP16 n/a
9 TRCN0000286129 CGGGACCTCATTGACTATGTA pLKO_005 485 CDS 100% 5.625 3.938 N NOP16 n/a
10 TRCN0000072544 CGGAGTAAGATCAACGTCTAT pLKO.1 593 CDS 100% 4.950 3.465 N NOP16 n/a
11 TRCN0000286128 CGGAGTAAGATCAACGTCTAT pLKO_005 593 CDS 100% 4.950 3.465 N NOP16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03315 pDONR223 100% 84.9% 81.3% None (many diffs) n/a
2 ccsbBroad304_03315 pLX_304 0% 84.9% 81.3% V5 (many diffs) n/a
3 TRCN0000466172 AAATTCCCTCGGTGTATTCAGTAG pLX_317 56.1% 84.9% 81.3% V5 (many diffs) n/a
4 ccsbBroadEn_11992 pDONR223 100% 47.8% 42.4% None (many diffs) n/a
5 ccsbBroad304_11992 pLX_304 0% 47.8% 42.4% V5 (many diffs) n/a
6 TRCN0000468027 ACAAACAAATTCTAATTGACGTTT pLX_317 55.8% 47.8% 42.4% V5 (many diffs) n/a
Download CSV