Transcript: Human NM_001318842.1

Homo sapiens canopy FGF signaling regulator 3 (CNPY3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CNPY3 (10695)
Length:
1883
CDS:
442..1377

Additional Resources:

NCBI RefSeq record:
NM_001318842.1
NBCI Gene record:
CNPY3 (10695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000447093 GAGCTGTGGAACGAGACTTCT pLKO_005 988 CDS 100% 4.950 6.930 N CNPY3 n/a
2 TRCN0000129881 GACCTTTGAGACATTACACAA pLKO.1 924 CDS 100% 4.950 3.960 N CNPY3 n/a
3 TRCN0000373716 AGAAGGCCTCTGGAGTCAAAT pLKO_005 686 CDS 100% 13.200 9.240 N CNPY3 n/a
4 TRCN0000433063 GAAGTCAGCCTTTGAGGAAAC pLKO_005 618 CDS 100% 6.000 4.200 N CNPY3 n/a
5 TRCN0000127844 GTCAGAGACCTTTGAGACATT pLKO.1 918 CDS 100% 4.950 3.465 N CNPY3 n/a
6 TRCN0000443464 AGGACTCCAGTGTGAACTCAG pLKO_005 1633 3UTR 100% 4.050 2.835 N CNPY3 n/a
7 TRCN0000422180 TCTGCCAAGGAAAGACACAAG pLKO_005 1501 3UTR 100% 4.050 2.835 N CNPY3 n/a
8 TRCN0000148543 CATTACACAACCTGGTACACA pLKO.1 935 CDS 100% 3.000 2.100 N CNPY3 n/a
9 TRCN0000130772 GAGACATTACACAACCTGGTA pLKO.1 931 CDS 100% 2.640 1.848 N CNPY3 n/a
10 TRCN0000373717 AGGACCGGCAGCAATCGATTT pLKO_005 886 CDS 100% 10.800 5.400 Y CNPY3 n/a
11 TRCN0000163917 CCAGCAAATGCGAAGTGTGTA pLKO.1 578 CDS 100% 4.950 2.475 Y CNPY4 n/a
12 TRCN0000129597 CCTGGATTATAGCCTGCACAA pLKO.1 861 CDS 100% 4.050 2.025 Y CNPY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02510 pDONR223 100% 89.3% 89.3% None 276_374del n/a
2 ccsbBroad304_02510 pLX_304 0% 89.3% 89.3% V5 276_374del n/a
3 TRCN0000474578 CGTCGATTGGCGGAGATGTTTTCT pLX_317 31.1% 89.3% 89.3% V5 276_374del n/a
Download CSV