Transcript: Human NM_001319190.1

Homo sapiens SLP adaptor and CSK interacting membrane protein (SCIMP), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
SCIMP (388325)
Length:
2192
CDS:
106..477

Additional Resources:

NCBI RefSeq record:
NM_001319190.1
NBCI Gene record:
SCIMP (388325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163297 GTTCTTAATGAGTCGCCAGTT pLKO.1 298 CDS 100% 4.050 5.670 N SCIMP n/a
2 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 1560 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10092 pDONR223 100% 66.8% 54.7% None (many diffs) n/a
2 TRCN0000475762 TTCATCTACACAGTTCCCTTGTCC pLX_317 59.8% 66.8% 54.7% V5 (many diffs) n/a
3 ccsbBroadEn_05576 pDONR223 100% 66.2% 54.7% None (many diffs) n/a
4 ccsbBroad304_05576 pLX_304 0% 66.2% 54.7% V5 (many diffs) n/a
5 TRCN0000477444 TGCGAATTTTACATGTCCAAGCAA pLX_317 98.6% 66.2% 54.7% V5 (many diffs) n/a
6 ccsbBroadEn_16164 pDONR223 0% 65.8% 54.7% None (many diffs) n/a
7 ccsbBroad304_16164 pLX_304 0% 65.8% 54.7% V5 (many diffs) n/a
8 TRCN0000477298 CGAGCATGCTTGTTAGAGTCCTGT pLX_317 98.6% 65.8% 54.7% V5 (many diffs) n/a
9 ccsbBroadEn_11616 pDONR223 100% 20.2% 11.9% None (many diffs) n/a
10 ccsbBroad304_11616 pLX_304 0% 20.2% 11.9% V5 (many diffs) n/a
11 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 20.2% 11.9% V5 (many diffs) n/a
12 ccsbBroadEn_10792 pDONR223 100% 18.1% 13.1% None (many diffs) n/a
13 ccsbBroad304_10792 pLX_304 0% 18.1% 13.1% V5 (many diffs) n/a
14 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 18.1% 13.1% V5 (many diffs) n/a
15 ccsbBroadEn_13781 pDONR223 100% 17.2% 12.3% None (many diffs) n/a
16 ccsbBroad304_13781 pLX_304 0% 17.2% 12.3% V5 (many diffs) n/a
17 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 17.2% 12.3% V5 (many diffs) n/a
Download CSV