Transcript: Human NM_001320777.2

Homo sapiens zinc finger protein 544 (ZNF544), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF544 (27300)
Length:
2908
CDS:
449..856

Additional Resources:

NCBI RefSeq record:
NM_001320777.2
NBCI Gene record:
ZNF544 (27300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425931 TATCAGTGTGACGTGTATTAA pLKO_005 2100 3UTR 100% 15.000 21.000 N ZNF544 n/a
2 TRCN0000420507 TAGCCAACGGTGTCAACTTAC pLKO_005 2287 3UTR 100% 10.800 8.640 N ZNF544 n/a
3 TRCN0000414718 GATCGCTCAACCCTTAGTAAA pLKO_005 2207 3UTR 100% 13.200 9.240 N ZNF544 n/a
4 TRCN0000108126 GCCAAAGCTATGAGTTAGTTA pLKO.1 1291 3UTR 100% 5.625 3.938 N ZNF544 n/a
5 TRCN0000108125 CCAGTTATGATACTTTCCTTA pLKO.1 2371 3UTR 100% 4.950 3.465 N ZNF544 n/a
6 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1919 3UTR 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15794 pDONR223 0% 47.2% 32.9% None (many diffs) n/a
2 ccsbBroad304_15794 pLX_304 0% 47.2% 32.9% V5 (many diffs) n/a
3 TRCN0000473123 AGGAAAGAGTACTACGAAAGAAGG pLX_317 100% 47.2% 32.9% V5 (many diffs) n/a
4 ccsbBroadEn_03024 pDONR223 100% 9.7% 7.4% None (many diffs) n/a
5 ccsbBroad304_03024 pLX_304 0% 9.7% 7.4% V5 (many diffs) n/a
6 TRCN0000472585 CGCTCACCAGCAGTCCTTAGGCTT pLX_317 18.2% 9.7% 7.4% V5 (many diffs) n/a
Download CSV