Transcript: Human NM_001320781.1

Homo sapiens zinc finger protein 544 (ZNF544), transcript variant 11, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
ZNF544 (27300)
Length:
3938
CDS:
759..1148

Additional Resources:

NCBI RefSeq record:
NM_001320781.1
NBCI Gene record:
ZNF544 (27300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425931 TATCAGTGTGACGTGTATTAA pLKO_005 3115 3UTR 100% 15.000 21.000 N ZNF544 n/a
2 TRCN0000419535 TAAACTTGGAAACGTTGAAAC pLKO_005 1572 3UTR 100% 10.800 15.120 N ZNF544 n/a
3 TRCN0000420507 TAGCCAACGGTGTCAACTTAC pLKO_005 3302 3UTR 100% 10.800 8.640 N ZNF544 n/a
4 TRCN0000108128 GAGCTTTCTGTCAGAGTATTT pLKO.1 1544 3UTR 100% 13.200 9.240 N ZNF544 n/a
5 TRCN0000414718 GATCGCTCAACCCTTAGTAAA pLKO_005 3222 3UTR 100% 13.200 9.240 N ZNF544 n/a
6 TRCN0000108126 GCCAAAGCTATGAGTTAGTTA pLKO.1 2306 3UTR 100% 5.625 3.938 N ZNF544 n/a
7 TRCN0000108125 CCAGTTATGATACTTTCCTTA pLKO.1 3386 3UTR 100% 4.950 3.465 N ZNF544 n/a
8 TRCN0000108129 CCTAAGCCCAACTCACAAGTT pLKO.1 1438 3UTR 100% 4.950 3.465 N ZNF544 n/a
9 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2934 3UTR 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15794 pDONR223 0% 44.2% 33.9% None (many diffs) n/a
2 ccsbBroad304_15794 pLX_304 0% 44.2% 33.9% V5 (many diffs) n/a
3 TRCN0000473123 AGGAAAGAGTACTACGAAAGAAGG pLX_317 100% 44.2% 33.9% V5 (many diffs) n/a
4 ccsbBroadEn_03024 pDONR223 100% 9.7% 7.2% None 1_162del;321_322ins35;387_388ins1885 n/a
5 ccsbBroad304_03024 pLX_304 0% 9.7% 7.2% V5 1_162del;321_322ins35;387_388ins1885 n/a
6 TRCN0000472585 CGCTCACCAGCAGTCCTTAGGCTT pLX_317 18.2% 9.7% 7.2% V5 1_162del;321_322ins35;387_388ins1885 n/a
Download CSV