Transcript: Human NM_001320783.2

Homo sapiens zinc finger protein 544 (ZNF544), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF544 (27300)
Length:
4657
CDS:
575..868

Additional Resources:

NCBI RefSeq record:
NM_001320783.2
NBCI Gene record:
ZNF544 (27300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1671 3UTR 100% 5.625 2.813 Y KLHL30 n/a
2 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1992 3UTR 100% 5.625 2.813 Y EID2B n/a
3 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 856 CDS 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15794 pDONR223 0% 73.6% 46.4% None (many diffs) n/a
2 ccsbBroad304_15794 pLX_304 0% 73.6% 46.4% V5 (many diffs) n/a
3 TRCN0000473123 AGGAAAGAGTACTACGAAAGAAGG pLX_317 100% 73.6% 46.4% V5 (many diffs) n/a
4 ccsbBroadEn_03024 pDONR223 100% 12.5% 7.9% None (many diffs) n/a
5 ccsbBroad304_03024 pLX_304 0% 12.5% 7.9% V5 (many diffs) n/a
6 TRCN0000472585 CGCTCACCAGCAGTCCTTAGGCTT pLX_317 18.2% 12.5% 7.9% V5 (many diffs) n/a
Download CSV